RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_018379
Reference: OH-1004 Chr: Chr04 Coordinates: 12284287-12291197 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5883 bp · LXL04_018379|LXL04_018379|OH1004|cDNA

ATGACGGGTAAAAAAAGAAAGTCCTCATATAAGGATGCTCATCATGGATCCAACTACCCTACCTGTCACGCACCCAACAACTTTGCCCCACTATTACAAACATCAACTACCCATTTACATTTTCGGATGGATAATGTAGGGACCAGTATCGTTTCTTCTGATTATATTGATATTGGAGACAATAATTTCTTTTGCAAATATTGTCATGCTACTTTTTGGTACGACGAACGTGTAAAATACTTATGTACCAGTGAAAATTT...

CDS

Download CDS FASTA

5883 bp · LXL04_018379|LXL04_018379|OH1004|CDS

ATGACGGGTAAAAAAAGAAAGTCCTCATATAAGGATGCTCATCATGGATCCAACTACCCTACCTGTCACGCACCCAACAACTTTGCCCCACTATTACAAACATCAACTACCCATTTACATTTTCGGATGGATAATGTAGGGACCAGTATCGTTTCTTCTGATTATATTGATATTGGAGACAATAATTTCTTTTGCAAATATTGTCATGCTACTTTTTGGTACGACGAACGTGTAAAATACTTATGTACCAGTGAAAATTT...

Protein

Download Protein FASTA

1960 aa · LXL04_018379|LXL04_018379|OH1004|PROTEIN

MTGKKRKSSYKDAHHGSNYPTCHAPNNFAPLLQTSTTHLHFRMDNVGTSIVSSDYIDIGDNNFFCKYCHATFWYDERVKYLCTSENLQYNNCCKGGKVVLPNEPEPPDFIQHLFKDKHFLDNIRAYNQMFSMTSFGAQIDESVNDGKSPYVFKISGQIYHWLGSLCPSEGNPPRFLQLYIYDTQNEVENRMRFFGGIESKSVNSTIVQQLVDFLDKHNDLVKLFRTARSICEETNVPDFHIRLYSVVGSRQYDLPTSNAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_018379
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_018379
LocationChr04:12284287-12291197 (+)
DescriptionSimilar to pif1: ATP-dependent DNA helicase PIF1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018379 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000723 telomere maintenance Biological Process
GO:0000724 double-strand break repair via homologous recombination Biological Process
GO:0006260 DNA replication Biological Process
GO:0006281 DNA repair Biological Process
GO:0006289 nucleotide-excision repair Biological Process
GO:0006310 DNA recombination Biological Process
GO:0007004 telomere maintenance via telomerase Biological Process
GO:0034502 protein localization to chromosome Biological Process
GO:0051276 chromosome organization Biological Process
GO:0051321 meiotic cell cycle Biological Process
GO:0005634 nucleus Cellular Component
GO:0005662 DNA replication factor A complex Cellular Component
KEGG gene cross-reference
cje:Cj0945c
dre:327491
tbr:Tb10.70.7240
xla:734585
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.912
Rank 1 · LXL04_018379 · OH-1004
Cytoplasm0.154
Rank 2 · LXL04_018379 · OH-1004
Mitochondrion0.039
Rank 3 · LXL04_018379 · OH-1004
Cell membrane0.015
Rank 4 · LXL04_018379 · OH-1004
Extracellular0.011
Rank 5 · LXL04_018379 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14214.12Helitron_like_N356-536 aa
PF05970.21PIF11000-1217 aa
PF21530.4Pif1_2B_dom1319-1365 aa
PF16900.12REPA_OB_21646-1734 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_018379PF14214.12Helitron_like_N3565363.7e-53181.3
LXL04_018379PF05970.21PIF1100012172.6e-89299.4
LXL04_018379PF21530.4Pif1_2B_dom131913652.2e-2072.8
LXL04_018379PF16900.12REPA_OB_2164617342.1e-1144.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser