LXL04_018355 | RubberDandelionOmics

Gene overview

LXL04_018355

Reference: OH-1004 Chr: Chr04 Coordinates: 11987593-11989106 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

867 bp · LXL04_018355|LXL04_018355|OH1004|cDNA

ATGTCTCGATCAATTTACCCGTCTACTGTAACCCTAGTCCTCAGATCAATGGCAACTAAAAGACCACAATCATCCGTCGTCTCAAAAAGAAGAACCGCCACTGCTGCTACTATGTCTGCTCTTGAAGCTCGAGTTTCTCTTATATTCGCTCTCGCCTCCCAAACTAGTTCCGTCTCTCAGCGACTTTTGACGGATTTAGCAACAGAGACGGCCAAGTACGTGTTTCCGAAGAGGTTTGAAAGTCGGAATTTAGAAGAAGC...

CDS

Download CDS FASTA

867 bp · LXL04_018355|LXL04_018355|OH1004|CDS

ATGTCTCGATCAATTTACCCGTCTACTGTAACCCTAGTCCTCAGATCAATGGCAACTAAAAGACCACAATCATCCGTCGTCTCAAAAAGAAGAACCGCCACTGCTGCTACTATGTCTGCTCTTGAAGCTCGAGTTTCTCTTATATTCGCTCTCGCCTCCCAAACTAGTTCCGTCTCTCAGCGACTTTTGACGGATTTAGCAACAGAGACGGCCAAGTACGTGTTTCCGAAGAGGTTTGAAAGTCGGAATTTAGAAGAAGC...

Protein

Download Protein FASTA

288 aa · LXL04_018355|LXL04_018355|OH1004|PROTEIN

MSRSIYPSTVTLVLRSMATKRPQSSVVSKRRTATAATMSALEARVSLIFALASQTSSVSQRLLTDLATETAKYVFPKRFESRNLEEALMSVPDLETVKFKVLTRNDQYEIRELQPYFVAETTMPGKYGFDLNGASHSFNVLAEYLFGKNTSNEAMEMTTPVFTRKTQSEGVTMDMTTPVITKKKEDEDNWKMSFILPSKYGSNFPLPKNSAVTIKEVPSRIVAVVAFSGFVTDEDVIRRESILRNSLKTDSQYKVKSGAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018355`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018355

Location Chr04:11987593-11989106 (+)

Description Similar to At3g10130: Heme-binding-like protein At3g10130, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10130`	Heme-binding-like protein At3g10130, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018355 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007623 circadian rhythm Biological Process

GO:0042168 heme metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference

ath:AT3G10130

hsa:50865

mmu:15199

xla:414628

xtr:448253

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.645

Rank 1 · LXL04_018355 · OH-1004

Mitochondrion0.415

Rank 2 · LXL04_018355 · OH-1004

Cytoplasm0.045

Rank 3 · LXL04_018355 · OH-1004

Nucleus0.032

Rank 4 · LXL04_018355 · OH-1004

Cell membrane0.025

Rank 5 · LXL04_018355 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04832.18SOUL94-169 aa

PF04832.18SOUL168-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018355	`PF04832.18`	SOUL	94	169	4.2e-48	164.4
LXL04_018355	`PF04832.18`	SOUL	168	282	4.2e-48	164.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SR77`	Arabidopsis thaliana	Heme-binding-like protein At3g10130, chloroplastic	68.462%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card