LXL04_018228 | RubberDandelionOmics

Gene overview

LXL04_018228

Reference: OH-1004 Chr: Chr04 Coordinates: 9086357-9088105 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

672 bp · LXL04_018228|LXL04_018228|OH1004|cDNA

ATGGAGCTTCATTTGGGTCTTGCtctttcttcatcttcttcatctgCATCTTCGAAGTTTGATCTCAACTGCAACGATGAATCTGTTATCCCAATTTATCATTTGAAAAAGAGGAAAcaggatgatgatgatgatgatgatgatgatggtgatcTTCATGTTCTTCAAACACTACCTCTTCTTGTCTGGAATAACTTATGCGACAAAACTCAGTTGAATCAACAGCTCCATGATGAtgctgatgatgatgatgatgatga...

CDS

Download CDS FASTA

672 bp · LXL04_018228|LXL04_018228|OH1004|CDS

ATGGAGCTTCATTTGGGTCTTGCTCTTTCTTCATCTTCTTCATCTGCATCTTCGAAGTTTGATCTCAACTGCAACGATGAATCTGTTATCCCAATTTATCATTTGAAAAAGAGGAAACAGGATGATGATGATGATGATGATGATGATGGTGATCTTCATGTTCTTCAAACACTACCTCTTCTTGTCTGGAATAACTTATGCGACAAAACTCAGTTGAATCAACAGCTCCATGATGATGCTGATGATGATGATGATGATGA...

Protein

Download Protein FASTA

223 aa · LXL04_018228|LXL04_018228|OH1004|PROTEIN

MELHLGLALSSSSSSASSKFDLNCNDESVIPIYHLKKRKQDDDDDDDDDGDLHVLQTLPLLVWNNLCDKTQLNQQLHDDADDDDDDDDDDDDDGEVQSNSVFVHRRDDGGVVGWPPVKSCRKKLCHPKTYNYGGGGGGGGGGGSKSMYVKVHMEGMGIARKVDLNLHHSYQTLVHTLANMFGKSYEDVKLAYQDKEGDWLLAGDVPWGSFVETIKRLKLIKKQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018228`
TK1151 ID	TkA08G019440
OH-1004 ID	LXL04_018228
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018228

Location Chr04:9086357-9088105 (+)

Description Similar to IAA29: Auxin-responsive protein IAA29

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32280`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At5g25890`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At5g43700`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018228 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009635 response to herbicide Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010114 response to red light Biological Process

GO:0010218 response to far red light Biological Process

GO:0010583 response to cyclopentenone Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G32280

ath:AT5G25890

ath:AT5G43700

vra:106757071

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.914

Rank 1 · LXL04_018228 · OH-1004

Cytoplasm0.171

Rank 2 · LXL04_018228 · OH-1004

Cell membrane0.041

Rank 3 · LXL04_018228 · OH-1004

Endoplasmic reticulum0.033

Rank 4 · LXL04_018228 · OH-1004

Lysosome / Vacuole0.012

Rank 5 · LXL04_018228 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02309.23AUX_IAA2-182 aa

PF02309.23AUX_IAA187-222 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018228	`PF02309.23`	AUX_IAA	2	182	3.8e-35	122.4
LXL04_018228	`PF02309.23`	AUX_IAA	187	222	3.8e-35	122.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93WC4`	Arabidopsis thaliana	Auxin-responsive protein IAA29	33.721%	Swiss-Prot	moderate database homology
`Q9XFM0`	Arabidopsis thaliana	Auxin-responsive protein IAA28	39.837%	Swiss-Prot	moderate database homology
`P33077`	Arabidopsis thaliana	Auxin-responsive protein IAA4	40.164%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card