LXL04_018224 | RubberDandelionOmics

Gene overview

LXL04_018224

Reference: OH-1004 Chr: Chr04 Coordinates: 8973394-8976304 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1290 bp · LXL04_018224|LXL04_018224|OH1004|cDNA

ATGGAGAAGAAGTGTGGTTGTTGGTCGGTTTTAAGGCGTAGCGTTAGCACTGGTTCTTGTAAACCATCGGTTGAATCAACAAGAAACTCTGCCACCCCTTTCCCAAGAACCAGTCTTGTTTATGATGCAGTTTATAATAATGTTTCAGCAACTGAAACCCGTTACTTAAATGCTAGCAATAGGGAGATGTGTGCTCCTAACGAGCCCCAAAACTCTTCGGATTTGAATCAAGACGTGCCTCAGTCAAATAAAAGGCCATG...

CDS

Download CDS FASTA

1290 bp · LXL04_018224|LXL04_018224|OH1004|CDS

ATGGAGAAGAAGTGTGGTTGTTGGTCGGTTTTAAGGCGTAGCGTTAGCACTGGTTCTTGTAAACCATCGGTTGAATCAACAAGAAACTCTGCCACCCCTTTCCCAAGAACCAGTCTTGTTTATGATGCAGTTTATAATAATGTTTCAGCAACTGAAACCCGTTACTTAAATGCTAGCAATAGGGAGATGTGTGCTCCTAACGAGCCCCAAAACTCTTCGGATTTGAATCAAGACGTGCCTCAGTCAAATAAAAGGCCATG...

Protein

Download Protein FASTA

429 aa · LXL04_018224|LXL04_018224|OH1004|PROTEIN

MEKKCGCWSVLRRSVSTGSCKPSVESTRNSATPFPRTSLVYDAVYNNVSATETRYLNASNREMCAPNEPQNSSDLNQDVPQSNKRPCQLLQFSFHELKSATGNFRPDSILGEGGFGFVFKGWIEENGTAPAKPGSGITVAVKSLKPDGLQGHREWVAEVDFLGQLHHPNLVKLIGYCIEDDQRLLVYEFMTRGSLENHLFRRTIPLPWSNRIKIATGAAKGLAFLHGGTEPIIYRDFKTSNILLDTEYNSKLSDFGLAKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018224`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018224

Location Chr04:8973394-8976304 (+)

Description Similar to At3g01300: Receptor-like serine/threonine-protein kinase At3g01300

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01300`	Involved in chitin-triggered immune signaling and is required for reactive oxygen species (ROS) production.	Tyrosine phosphorylation of the lectin receptor-like kinase LORE regulates plant immunity.2020 · DOI: 10.15252/embj.2019102856 Receptor-like cytoplasmic kinases PBL34/35/36 are required for CLE peptide-mediated signaling to maintain shoot apical meristem and root apical meristem homeostasis in Arabidopsis.2022 · DOI: 10.1093/plcell/koab315
`At5g15080`	Involved in chitin-triggered immune signaling and is required for reactive oxygen species (ROS) production.	Tyrosine phosphorylation of the lectin receptor-like kinase LORE regulates plant immunity.2020 · DOI: 10.15252/embj.2019102856 Receptor-like cytoplasmic kinases PBL34/35/36 are required for CLE peptide-mediated signaling to maintain shoot apical meristem and root apical meristem homeostasis in Arabidopsis.2022 · DOI: 10.1093/plcell/koab315
`At3g28690`	Involved in chitin-triggered immune signaling and is required for reactive oxygen species (ROS) production.	Tyrosine phosphorylation of the lectin receptor-like kinase LORE regulates plant immunity.2020 · DOI: 10.15252/embj.2019102856 Receptor-like cytoplasmic kinases PBL34/35/36 are required for CLE peptide-mediated signaling to maintain shoot apical meristem and root apical meristem homeostasis in Arabidopsis.2022 · DOI: 10.1093/plcell/koab315
`At5g01020`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0110900`	Functions downstream of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.	OsCERK1 and OsRLCK176 play important roles in peptidoglycan and chitin signaling in rice innate immunity.2014 · DOI: 10.1111/tpj.12710

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018224 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002221 pattern recognition receptor signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

GO:0010088 phloem development Biological Process

GO:0010492 maintenance of shoot apical meristem identity Biological Process

GO:0031663 lipopolysaccharide-mediated signaling pathway Biological Process

GO:0045087 innate immune response Biological Process

GO:1901653 cellular response to peptide Biological Process

GO:2000280 regulation of root development Biological Process

KEGG gene cross-reference

ath:AT3G01300

ath:AT3G28690

ath:AT5G01020

ath:AT5G15080

dosa:Os05g0110900

osa:4337593

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.653

Rank 1 · LXL04_018224 · OH-1004

Nucleus0.265

Rank 2 · LXL04_018224 · OH-1004

Cytoplasm0.262

Rank 3 · LXL04_018224 · OH-1004

Endoplasmic reticulum0.036

Rank 4 · LXL04_018224 · OH-1004

Golgi apparatus0.027

Rank 5 · LXL04_018224 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase107-381 aa

PF07714.24PK_Tyr_Ser-Thr108-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018224	`PF00069.32`	Pkinase	107	381	6.3e-44	151.0
LXL04_018224	`PF07714.24`	PK_Tyr_Ser-Thr	108	383	8.1e-49	167.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRH7`	Arabidopsis thaliana	Serine/threonine-protein kinase PBL35	63.592%	Swiss-Prot	strong database homology
`Q9LFP7`	Arabidopsis thaliana	Serine/threonine-protein kinase PBL34	61.017%	Swiss-Prot	strong database homology
`F4J0D2`	Arabidopsis thaliana	Serine/threonine-protein kinase PBL36	62.850%	Swiss-Prot	strong database homology
`Q8GXZ3`	Arabidopsis thaliana	Probable serine/threonine-protein kinase PBL8	68.506%	Swiss-Prot	strong database homology
`Q65XV8`	Oryza sativa subsp. japonica	Receptor-like cytoplasmic kinase 176	66.667%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card