LXL04_018147 | RubberDandelionOmics

Gene overview

LXL04_018147

Reference: OH-1004 Chr: Chr04 Coordinates: 7662791-7672186 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · LXL04_018147|LXL04_018147|OH1004|cDNA

ATGTCCAAGAAAGCGATGGAAGTTGTAAAGGGAATAGATCTACAAAGGTACATGGGCAGATGGTACGAAATAGCTTGTTTCCCATCGAGGTTTCAGCCCAAAAACGGCGTCAACACAAGGGCTACATACACATTGAACGACGACGGCACTGTTCATGTTCTAAACGAGACTTGGAGTGATGGAAAGAGAGGATTCATCGAAGGAACGGCTTATAAAGCGGACCCCAAAAGCGATGAAGCGAAATTGAAGGTGAAATTCTA...

CDS

Download CDS FASTA

1620 bp · LXL04_018147|LXL04_018147|OH1004|CDS

ATGTCCAAGAAAGCGATGGAAGTTGTAAAGGGAATAGATCTACAAAGGTACATGGGCAGATGGTACGAAATAGCTTGTTTCCCATCGAGGTTTCAGCCCAAAAACGGCGTCAACACAAGGGCTACATACACATTGAACGACGACGGCACTGTTCATGTTCTAAACGAGACTTGGAGTGATGGAAAGAGAGGATTCATCGAAGGAACGGCTTATAAAGCGGACCCCAAAAGCGATGAAGCGAAATTGAAGGTGAAATTCTA...

Protein

Download Protein FASTA

539 aa · LXL04_018147|LXL04_018147|OH1004|PROTEIN

MSKKAMEVVKGIDLQRYMGRWYEIACFPSRFQPKNGVNTRATYTLNDDGTVHVLNETWSDGKRGFIEGTAYKADPKSDEAKLKVKFYVPPFLPIFPVTGDYWVLHLDDDYQYALIGQPSRSYLWIWEFEILCRQTHIDEEIYNKLVEKAKEEGYDVSKLKKTPQSESPPESKDAPADTKGICSYGNENKHRNENYDYYVIRFVTYMHSVERYTLFPIQQHVLIYSHTKVDKFQALDAILRLQNYVYEDIEFVDLELAEYE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018147`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018147

Location Chr04:7662791-7672186 (+)

Description Similar to TIL: Temperature-induced lipocalin-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58070`	Involved in basal (BT) and acquired thermotolerance (AT), probably by preventing plasma membrane lipids peroxidation induced by severe heat-shock (HS).	Temperature-induced lipocalin is required for basal and acquired thermotolerance in Arabidopsis.2009 · DOI: 10.1111/j.1365-3040.2009.01972.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018147 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0006883 intracellular sodium ion homeostasis Biological Process

GO:0006950 response to stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0010286 heat acclimation Biological Process

GO:0010431 seed maturation Biological Process

GO:0030644 intracellular chloride ion homeostasis Biological Process

KEGG gene cross-reference

ath:AT5G58070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.290

Rank 1 · LXL04_018147 · OH-1004

Endoplasmic reticulum0.231

Rank 2 · LXL04_018147 · OH-1004

Lysosome / Vacuole0.191

Rank 3 · LXL04_018147 · OH-1004

Extracellular0.175

Rank 4 · LXL04_018147 · OH-1004

Cell membrane0.119

Rank 5 · LXL04_018147 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08212.19Lipocalin_212-164 aa

PF00061.30Lipocalin19-166 aa

PF08212.19Lipocalin_2280-430 aa

PF00061.30Lipocalin287-417 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018147	`PF08212.19`	Lipocalin_2	12	164	1.1e-105	350.5
LXL04_018147	`PF00061.30`	Lipocalin	19	166	4e-12	47.2
LXL04_018147	`PF08212.19`	Lipocalin_2	280	430	1.1e-105	350.5
LXL04_018147	`PF00061.30`	Lipocalin	287	417	4e-12	47.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGT8`	Arabidopsis thaliana	Temperature-induced lipocalin-1	76.374%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card