LXL04_017967 | RubberDandelionOmics

Gene overview

LXL04_017967

Reference: OH-1004 Chr: Chr04 Coordinates: 4412017-4414012 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1281 bp · LXL04_017967|LXL04_017967|OH1004|cDNA

atggtgatgatgatgatgatgaaacCCATTAATCTTCACGTCTCTGACTTGAAAAAACTCATAAATCCATACCCAAATTCACGCCCACATCACCCCCGATCACCCAATTCATTACTGATTACAAAGTCTCATGAAACCAATCACAGTTCACTCCAACCGTCTCAACAGTCATCAGCTCGCTCACTGGTCCATGAATTCAACCCCCATATCCCAATTGAAGAAGCCCTAACTCCACCAAGCTCATGGTACACCTCCCCTTC...

CDS

Download CDS FASTA

1281 bp · LXL04_017967|LXL04_017967|OH1004|CDS

ATGGTGATGATGATGATGATGAAACCCATTAATCTTCACGTCTCTGACTTGAAAAAACTCATAAATCCATACCCAAATTCACGCCCACATCACCCCCGATCACCCAATTCATTACTGATTACAAAGTCTCATGAAACCAATCACAGTTCACTCCAACCGTCTCAACAGTCATCAGCTCGCTCACTGGTCCATGAATTCAACCCCCATATCCCAATTGAAGAAGCCCTAACTCCACCAAGCTCATGGTACACCTCCCCTTC...

Protein

Download Protein FASTA

426 aa · LXL04_017967|LXL04_017967|OH1004|PROTEIN

MVMMMMMKPINLHVSDLKKLINPYPNSRPHHPRSPNSLLITKSHETNHSSLQPSQQSSARSLVHEFNPHIPIEEALTPPSSWYTSPSFLSLELDQVFFRGWQAVGYTEQIQEANSFFTGRLGNVQYVICRDENGELRAFHNVCRHHASLLVSGTGKGSCFVCPYHGWTYGLNGALLKASRITGIKNFNVKEFGLVPLKVAIWGPFILLNLEKKVFDLQDSGDDVAMEWLGSTSEILSKNGVDTSLSYLCRREYTIECNWK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017967`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017967

Location Chr04:4412017-4414012 (-)

Description Similar to At4g29890: Choline monooxygenase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g29890`	Catalyzes the first step of the osmoprotectant glycine betaine synthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017967 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019285 glycine betaine biosynthetic process from choline Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0005506 iron ion binding Molecular Function

GO:0019133 choline monooxygenase activity Molecular Function

GO:0051537 2 iron, 2 sulfur cluster binding Molecular Function

KEGG gene cross-reference

ag:AAB52509

ath:AT4G29890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.930

Rank 1 · LXL04_017967 · OH-1004

Mitochondrion0.111

Rank 2 · LXL04_017967 · OH-1004

Cytoplasm0.039

Rank 3 · LXL04_017967 · OH-1004

Nucleus0.030

Rank 4 · LXL04_017967 · OH-1004

Peroxisome0.018

Rank 5 · LXL04_017967 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00355.33Rieske101-187 aa

PF00848.26Ring_hydroxyl_A250-419 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017967	`PF00355.33`	Rieske	101	187	7.7e-18	64.9
LXL04_017967	`PF00848.26`	Ring_hydroxyl_A	250	419	7.6e-30	105.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZR0`	Arabidopsis thaliana	Choline monooxygenase, chloroplastic	67.297%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card