LXL04_017851 | RubberDandelionOmics

Gene overview

LXL04_017851

Reference: OH-1004 Chr: Chr04 Coordinates: 2340599-2341378 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

648 bp · LXL04_017851|LXL04_017851|OH1004|cDNA

ATGGCTAGTAAGATAGATCATGATTACGATTACTTACTTAAGATCGTGTTGATCGGCGACTCCGGCGTCGGGAAAACCAACATTCTGTCCAGGTTTACGAGGAATGAGTTCTTCCTGGAGTCCAAAGCCACCATTGGCGTTGAATTTGCTACCAGAACTCTCCAGGTTGAGGGAAAAACGATCAAGGCGCAAATATGGGATACTGCTGGGCAGGAGAGGTACAGAGCAATTACAAGCGCTTATTATCGAGGCGCAGTTGG...

CDS

Download CDS FASTA

648 bp · LXL04_017851|LXL04_017851|OH1004|CDS

ATGGCTAGTAAGATAGATCATGATTACGATTACTTACTTAAGATCGTGTTGATCGGCGACTCCGGCGTCGGGAAAACCAACATTCTGTCCAGGTTTACGAGGAATGAGTTCTTCCTGGAGTCCAAAGCCACCATTGGCGTTGAATTTGCTACCAGAACTCTCCAGGTTGAGGGAAAAACGATCAAGGCGCAAATATGGGATACTGCTGGGCAGGAGAGGTACAGAGCAATTACAAGCGCTTATTATCGAGGCGCAGTTGG...

Protein

Download Protein FASTA

215 aa · LXL04_017851|LXL04_017851|OH1004|PROTEIN

MASKIDHDYDYLLKIVLIGDSGVGKTNILSRFTRNEFFLESKATIGVEFATRTLQVEGKTIKAQIWDTAGQERYRAITSAYYRGAVGALLVYDITKKPTFDNVQRWLTELRNHADANIVVMMAGNKSDLDHLRAVDEQDGQSLAEKEGLSFLETSALESHNVEKAFQTVLTEIYHIISKKALATQEAIGGAPGIGTTINVGDSPVPVNTNSCCSS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017851`
TK1151 ID	TkA08G045290
OH-1004 ID	LXL04_017851
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017851

Location Chr04:2340599-2341378 (-)

Description Similar to RAB2BV: Ras-related protein Rab2BV

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07410`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At5g59150`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At3g46830`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017851 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009504 cell plate Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

KEGG gene cross-reference

ath:AT1G07410

ath:AT3G46830

ath:AT5G59150

bvg:104900042

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.466

Rank 1 · LXL04_017851 · OH-1004

Cytoplasm0.465

Rank 2 · LXL04_017851 · OH-1004

Cell membrane0.174

Rank 3 · LXL04_017851 · OH-1004

Lysosome / Vacuole0.170

Rank 4 · LXL04_017851 · OH-1004

Endoplasmic reticulum0.151

Rank 5 · LXL04_017851 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025.28Arf13-167 aa

PF00071.29Ras14-174 aa

PF08477.20Roc14-128 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017851	`PF00025.28`	Arf	13	167	5.1e-14	52.8
LXL04_017851	`PF00071.29`	Ras	14	174	7.6e-62	208.4
LXL04_017851	`PF08477.20`	Roc	14	128	2.2e-34	119.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNW1`	Arabidopsis thaliana	Ras-related protein RABA2b	80.000%	Swiss-Prot	strong database homology
`Q9FIF9`	Arabidopsis thaliana	Ras-related protein RABA2d	78.899%	Swiss-Prot	strong database homology
`Q96283`	Arabidopsis thaliana	Ras-related protein RABA2c	79.358%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card