LXL04_017709 | RubberDandelionOmics

Gene overview

LXL04_017709

Reference: OH-1004 Chr: Chr04 Coordinates: 185926-188439 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1122 bp · LXL04_017709|LXL04_017709|OH1004|cDNA

ATGGCGTGTGCGAGGTTTGCGACTCTAAAAGCTATCCATGGACCGTGGACGCACTCCCAACACCTCCACCCTCGTATTCAAACTTCCGGCATCGTTAGGGCTTTTTCCGCCCTCAAGTCACCGCCGTCTACAGCAGTCTTCTACGAGAAGCACGGTCCTCCGGATATTGTCACCAAAGTAATCGAACTTCCACCGGTTGAAGTTGGACCAAAGGACGTGTGTGTTAAAATGCTTGCTGCTCCTATCAATCCATCGGACAT...

CDS

Download CDS FASTA

1122 bp · LXL04_017709|LXL04_017709|OH1004|CDS

ATGGCGTGTGCGAGGTTTGCGACTCTAAAAGCTATCCATGGACCGTGGACGCACTCCCAACACCTCCACCCTCGTATTCAAACTTCCGGCATCGTTAGGGCTTTTTCCGCCCTCAAGTCACCGCCGTCTACAGCAGTCTTCTACGAGAAGCACGGTCCTCCGGATATTGTCACCAAAGTAATCGAACTTCCACCGGTTGAAGTTGGACCAAAGGACGTGTGTGTTAAAATGCTTGCTGCTCCTATCAATCCATCGGACAT...

Protein

Download Protein FASTA

373 aa · LXL04_017709|LXL04_017709|OH1004|PROTEIN

MACARFATLKAIHGPWTHSQHLHPRIQTSGIVRAFSALKSPPSTAVFYEKHGPPDIVTKVIELPPVEVGPKDVCVKMLAAPINPSDINRIEGVYPARPPLPAVAGYEGVGEVHSIGSSVKGLSHGDLVMVSPPSPGTWQTHVVKDKDLWHKIDSSTPVEYAATITVNPVTALRMIEDYVDLKSGDAIVQNGATSMVGQCVIQLAKLGGIHTINIIRDRPGSDEAKEKLKKLGADVVFTESQLDVKNVKGFLDNLPEPALG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017709`
TK1151 ID	TkA08G054450
OH-1004 ID	LXL04_017709
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017709

Location Chr04:185926-188439 (-)

Description Similar to At3g45770: Enoyl-[acyl-carrier-protein] reductase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g45770`	Catalyzes the NADPH-dependent reduction of trans-2-enoyl thioesters in mitochondrial fatty acid synthesis (fatty acid synthesis type II).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017709 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0046513 ceramide biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0005102 signaling receptor binding Molecular Function

GO:0005507 copper ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G45770

hsa:51102

mmu:26922

rno:29470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.928

Rank 1 · LXL04_017709 · OH-1004

Cytoplasm0.099

Rank 2 · LXL04_017709 · OH-1004

Nucleus0.053

Rank 3 · LXL04_017709 · OH-1004

Cell membrane0.037

Rank 4 · LXL04_017709 · OH-1004

Plastid0.030

Rank 5 · LXL04_017709 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08240.18ADH_N69-133 aa

PF00107.33ADH_zinc_N196-329 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017709	`PF08240.18`	ADH_N	69	133	5.2e-13	49.9
LXL04_017709	`PF00107.33`	ADH_zinc_N	196	329	3.3e-17	63.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LCU7`	Arabidopsis thaliana	Enoyl-[acyl-carrier-protein] reductase, mitochondrial	73.392%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card