LXL04_017398 | RubberDandelionOmics

Gene overview

LXL04_017398

Reference: OH-1004 Chr: Chr03 Coordinates: 148261650-148264135 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

924 bp · LXL04_017398|LXL04_017398|OH1004|cDNA

ATGTCTGAAAAGTCCGGTGATGCTTCTGGAGGTGAAAATGGTCATGAAGGAAAAGTTGTAGACGGTAGAAAGAAGTTACTCGGTTCAAAAATAGATAATAACCATAGTCAGCACCCCGAGATGGAATCCACAAGAAGTCCAAGTGGTGCTAACCAAAAAATTGTAGAAACAACCACGGGTGGCTGTAGCAAGAGAAATGGTGATGCTTTTAAGACGGAAAATAAGGATGACATGAAGGTGAAGGACCATGACAATAAGGG...

CDS

Download CDS FASTA

924 bp · LXL04_017398|LXL04_017398|OH1004|CDS

ATGTCTGAAAAGTCCGGTGATGCTTCTGGAGGTGAAAATGGTCATGAAGGAAAAGTTGTAGACGGTAGAAAGAAGTTACTCGGTTCAAAAATAGATAATAACCATAGTCAGCACCCCGAGATGGAATCCACAAGAAGTCCAAGTGGTGCTAACCAAAAAATTGTAGAAACAACCACGGGTGGCTGTAGCAAGAGAAATGGTGATGCTTTTAAGACGGAAAATAAGGATGACATGAAGGTGAAGGACCATGACAATAAGGG...

Protein

Download Protein FASTA

307 aa · LXL04_017398|LXL04_017398|OH1004|PROTEIN

MSEKSGDASGGENGHEGKVVDGRKKLLGSKIDNNHSQHPEMESTRSPSGANQKIVETTTGGCSKRNGDAFKTENKDDMKVKDHDNKGKGGFESSDHDLHIWTERERRKKMRNMFHQLHALLPQLSPKADKSTIVDEAINHIKTLQQTLKNLKVSKAERLHGLSTNKQQGLIVTTRESFLANQASSTTQFGIVSPQSSNSFSFPVSTPISFQTWTSSNVILNVCGLDAHFSICCPRNIPGLLTTICFVLEKHKLEIVSAQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017398`
TK1151 ID	TkA08G178960
OH-1004 ID	LXL04_017398
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 74.919 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017398

Location Chr03:148261650-148264135 (-)

Description Similar to BHLH95: Transcription factor bHLH95

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49770`	Transcription factor that controls embryo growth.	No verified direct reference in this release
`At2g22760`	Transcription factor bHLH19.	No verified direct reference in this release
`At2g22770`	Transcription activator that regulates the expression of at least NAI2, PYK10 and PBP1.	A novel ER-derived compartment, the ER body, selectively accumulates a beta-glucosidase with an ER-retention signal in Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01636.x NAI1 gene encodes a basic-helix-loop-helix-type putative transcription factor that regulates the formation of an endoplasmic reticulum-derived structure, the ER body.2004 · DOI: 10.1105/tpc.021154 Activation of an ER-body-localized beta-glucosidase via a cytosolic binding partner in damaged tissues of Arabidopsis thaliana.2005 · DOI: 10.1093/pcp/pci126 PYK10, a beta-glucosidase located in the endoplasmatic reticulum, is crucial for the beneficial interaction between Arabidopsis thaliana and the endophytic fungus Piriformospora indica.2008 · DOI: 10.1111/j.1365-313x.2008.03424.x Antagonistic jacalin-related lectins regulate the size of ER body-type beta-glucosidase complexes in Arabidopsis thaliana.2008 · DOI: 10.1093/pcp/pcn075 NAI2 is an endoplasmic reticulum body component that enables ER body formation in Arabidopsis thaliana.2008 · DOI: 10.1105/tpc.108.059345
`At4g37850`	Transcription factor bHLH25.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017398 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009649 entrainment of circadian clock Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009960 endosperm development Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0032922 circadian regulation of gene expression Biological Process

GO:0042753 positive regulation of circadian rhythm Biological Process

KEGG gene cross-reference

ath:AT1G49770

ath:AT2G22760

ath:AT2G22770

ath:AT4G37850

hsa:56938

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · LXL04_017398 · OH-1004

Cytoplasm0.091

Rank 2 · LXL04_017398 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_017398 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_017398 · OH-1004

Plastid0.010

Rank 5 · LXL04_017398 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23177.2bHLH_IRO3101-157 aa

PF00010.32HLH102-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017398	`PF23177.2`	bHLH_IRO3	101	157	3e-06	28.2
LXL04_017398	`PF00010.32`	HLH	102	145	6.2e-11	42.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FXA3`	Arabidopsis thaliana	Transcription factor bHLH95	39.113%	Swiss-Prot	moderate database homology
`Q1PF16`	Arabidopsis thaliana	Transcription factor bHLH19	50.877%	Swiss-Prot	weak database homology
`Q8S3F1`	Arabidopsis thaliana	Transcription factor NAI1	30.256%	Swiss-Prot	moderate database homology
`Q9T072`	Arabidopsis thaliana	Transcription factor bHLH25	40.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card