LXL04_017304 | RubberDandelionOmics

Gene overview

LXL04_017304

Reference: OH-1004 Chr: Chr03 Coordinates: 145970298-145973293 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1725 bp · LXL04_017304|LXL04_017304|OH1004|cDNA

ATGGCCGCCAGTGGCTCAATTTCAACGATCTCCCACTCCGTATCTTCATTATCATGCACACATCGCAAGAAAACTAAAAACCCACGATTTGCAACCTGTTCGTTTCTTAAACAGCCTTTTAATCGCAAACCCCATCGTATCGCTACTCTCTACAACCCCAAAAGACTCGAGATTTCAGTCAAGGCGGAAACGGAAACCGAAGAATCGACTGTAGCTGTACCTTCGGTTGAACACGAAAACGAAAATGGTGAAATGGAAAC...

CDS

Download CDS FASTA

1725 bp · LXL04_017304|LXL04_017304|OH1004|CDS

ATGGCCGCCAGTGGCTCAATTTCAACGATCTCCCACTCCGTATCTTCATTATCATGCACACATCGCAAGAAAACTAAAAACCCACGATTTGCAACCTGTTCGTTTCTTAAACAGCCTTTTAATCGCAAACCCCATCGTATCGCTACTCTCTACAACCCCAAAAGACTCGAGATTTCAGTCAAGGCGGAAACGGAAACCGAAGAATCGACTGTAGCTGTACCTTCGGTTGAACACGAAAACGAAAATGGTGAAATGGAAAC...

Protein

Download Protein FASTA

574 aa · LXL04_017304|LXL04_017304|OH1004|PROTEIN

MAASGSISTISHSVSSLSCTHRKKTKNPRFATCSFLKQPFNRKPHRIATLYNPKRLEISVKAETETEESTVAVPSVEHENENGEMETHLGSEPSEEGAENEEQQELDWKTDEDFKKFMGNPSIEAAIKLEKKRTERKLKELDRERTSDNPIAGLFNQALRDNLSREKQRLEKAEESFKALDLNKLKNCFGFTTFFATDARRFGDGGIFIGNLRKPIEEVIPTLEQKLSEAAGRDVVLWFMEEKSNDITKQVCVVQPKSEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017304`
TK1151 ID	TkA02G056630
OH-1004 ID	LXL04_017304
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017304

Location Chr03:145970298-145973293 (+)

Description Similar to EGY3: Probable zinc metallopeptidase EGY3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g17870`	Probable membrane-associated metalloprotease that may be involved in chloroplast development.	No verified direct reference in this release
`At5g35220`	Membrane-associated and ATP-independent metalloprotease required for development of both thylakoid grana and well-organized lamellae in chloroplast.	EGY1 encodes a membrane-associated and ATP-independent metalloprotease that is required for chloroplast development.2005 · DOI: 10.1111/j.1365-313x.2004.02308.x EGY1 plays a role in regulation of endodermal plastid size and number that are involved in ethylene-dependent gravitropism of light-grown Arabidopsis hypocotyls.2008 · DOI: 10.1007/s11103-007-9273-5 Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress.2012 · DOI: 10.1104/pp.112.206508

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0729000`	Probable membrane-associated metalloprotease that may be involved in chloroplast development.	No verified direct reference in this release
`UniProt: A2XLM6`	Probable membrane-associated metalloprotease that may be involved in chloroplast development.	No verified direct reference in this release
`Os03g0792400`	Probable membrane-associated metalloprotease that may be involved in chloroplast development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017304 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009630 gravitropism Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009959 negative gravitropism Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010207 photosystem II assembly Biological Process

GO:0043157 response to cation stress Biological Process

GO:0048564 photosystem I assembly Biological Process

GO:0060359 response to ammonium ion Biological Process

KEGG gene cross-reference

ath:AT1G17870

ath:AT5G35220

dosa:Os03g0729000

dosa:Os03g0792400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.980

Rank 1 · LXL04_017304 · OH-1004

Mitochondrion0.022

Rank 2 · LXL04_017304 · OH-1004

Nucleus0.014

Rank 3 · LXL04_017304 · OH-1004

Cytoplasm0.012

Rank 4 · LXL04_017304 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_017304 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27677.1EGY3_M183-259 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017304	`PF27677.1`	EGY3_M	183	259	3.7e-27	94.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMU1`	Arabidopsis thaliana	Probable zinc metallopeptidase EGY3, chloroplastic	73.345%	Swiss-Prot	strong database homology
`Q949Y5`	Arabidopsis thaliana	Probable zinc metalloprotease EGY1, chloroplastic	27.361%	Swiss-Prot	weak database homology
`Q851F9`	Oryza sativa subsp. japonica	Probable zinc metalloprotease EGY3, chloroplastic	74.755%	Swiss-Prot	strong database homology
`A2XLM6`	Oryza sativa subsp. indica	Probable zinc metalloprotease EGY3, chloroplastic	74.560%	Swiss-Prot	strong database homology
`Q852K0`	Oryza sativa subsp. japonica	Probable zinc metalloprotease EGY1, chloroplastic	27.400%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card