LXL04_017258 | RubberDandelionOmics

Gene overview

LXL04_017258

Reference: OH-1004 Chr: Chr03 Coordinates: 144503366-144505181 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

924 bp · LXL04_017258|LXL04_017258|OH1004|cDNA

ATGGCTTCAGATATGTTGTTATCAAGAACAAAAAACCAACCAGCTCACTATATGTTAGAGATCGAATCCTTCTCTATTCTTTGTGAAGATCCAACTATTAAAATTGAATCTGATGTTTTTGAAGCCAGCGGTTATAACTGGAGACTTGATTTATATCCAAATAGACGCGATGAAGAAAACGGGACCAATCACATATCTTTGTATTTGATAGCGTGCGAGATCATAACAGCGCCTATAGAAAAGATGTCGCAAGAACAAGT...

CDS

Download CDS FASTA

924 bp · LXL04_017258|LXL04_017258|OH1004|CDS

ATGGCTTCAGATATGTTGTTATCAAGAACAAAAAACCAACCAGCTCACTATATGTTAGAGATCGAATCCTTCTCTATTCTTTGTGAAGATCCAACTATTAAAATTGAATCTGATGTTTTTGAAGCCAGCGGTTATAACTGGAGACTTGATTTATATCCAAATAGACGCGATGAAGAAAACGGGACCAATCACATATCTTTGTATTTGATAGCGTGCGAGATCATAACAGCGCCTATAGAAAAGATGTCGCAAGAACAAGT...

Protein

Download Protein FASTA

307 aa · LXL04_017258|LXL04_017258|OH1004|PROTEIN

MASDMLLSRTKNQPAHYMLEIESFSILCEDPTIKIESDVFEASGYNWRLDLYPNRRDEENGTNHISLYLIACEIITAPIEKMSQEQVHFDVKFFLYDHIGRNYVTFQDVDGKRISFHKNQTKWGFDKLISVGKFRESSNGYLFDDSCVFGVEVLAVPKNKLKDRILSMINPPATMNTYSWIVDKFSAVTNTTSVDSEVFKIGKVKILSLYRGNYILSRDLVMYLKLHKPELLPDSWKVYAKFEVRVKNQSGYDDRVTGYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017258`
TK1151 ID	TkA02G062480
OH-1004 ID	LXL04_017258
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.000
Protein coverage (%)	TK1151 98.662 / OH-1004 95.765 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017258

Location Chr03:144503366-144505181 (-)

Description Similar to UBP12: Ubiquitin carboxyl-terminal hydrolase 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06600`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	No verified direct reference in this release
`At3g11910`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	No verified direct reference in this release
`At3g58270`	MATH domain and coiled-coil domain-containing protein At3g58270.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017258 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0070646 protein modification by small protein removal Biological Process

GO:2000280 regulation of root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004843 cysteine-type deubiquitinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G11910

ath:AT3G58270

ath:AT5G06600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.590

Rank 1 · LXL04_017258 · OH-1004

Cytoplasm0.452

Rank 2 · LXL04_017258 · OH-1004

Cell membrane0.091

Rank 3 · LXL04_017258 · OH-1004

Endoplasmic reticulum0.053

Rank 4 · LXL04_017258 · OH-1004

Extracellular0.027

Rank 5 · LXL04_017258 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22486.3MATH_216-153 aa

PF00917.33MATH34-153 aa

PF22486.3MATH_2177-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017258	`PF22486.3`	MATH_2	16	153	1.2e-36	126.7
LXL04_017258	`PF00917.33`	MATH	34	153	1.1e-12	48.9
LXL04_017258	`PF22486.3`	MATH_2	177	252	1.2e-36	126.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FPT1`	Arabidopsis thaliana	Ubiquitin C-terminal hydrolase 12	33.835%	Swiss-Prot	weak database homology
`Q84WU2`	Arabidopsis thaliana	Ubiquitin C-terminal hydrolase 13	28.889%	Swiss-Prot	weak database homology
`Q9M2I9`	Arabidopsis thaliana	MATH domain and coiled-coil domain-containing protein At3g58270	28.462%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card