RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_017256
Reference: OH-1004 Chr: Chr03 Coordinates: 144407820-144411075 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2937 bp · LXL04_017256|LXL04_017256|OH1004|cDNA

ATGTCGTCGGAACCCATCTCCGGTAACCACCGTATCATCCTCTTCCTTCTACCATTTCTCTGCTTGATAGTCCACTCTTACTCCCAATCTGACCAACTTCAAATTCTTCTCAAATTCAAATCTACCCTCCAAAATTCAAAGTCGGAGGTGTTTAATACATGGCATGGAGAAAACCTCATCTGCAATTTCACAGGGATCGTCTGCAACTCCGATAATTTGGTGAAAGAAATCAATCTTTCGGAGCAACAACTCGCCGGGAC...

CDS

Download CDS FASTA

2937 bp · LXL04_017256|LXL04_017256|OH1004|CDS

ATGTCGTCGGAACCCATCTCCGGTAACCACCGTATCATCCTCTTCCTTCTACCATTTCTCTGCTTGATAGTCCACTCTTACTCCCAATCTGACCAACTTCAAATTCTTCTCAAATTCAAATCTACCCTCCAAAATTCAAAGTCGGAGGTGTTTAATACATGGCATGGAGAAAACCTCATCTGCAATTTCACAGGGATCGTCTGCAACTCCGATAATTTGGTGAAAGAAATCAATCTTTCGGAGCAACAACTCGCCGGGAC...

Protein

Download Protein FASTA

978 aa · LXL04_017256|LXL04_017256|OH1004|PROTEIN

MSSEPISGNHRIILFLLPFLCLIVHSYSQSDQLQILLKFKSTLQNSKSEVFNTWHGENLICNFTGIVCNSDNLVKEINLSEQQLAGTLPFDSICSLKSLEKISLGSNNLYGTVSSHISNCTNLQYLDLGINSFSGELPDLSSLIQLKFLNLNLSGFSGSFPWKSIENHTNLTFLSLGDNPFDRTPFPLEILNFRQLYSLYLTNCSIEGRIPEEIGNLNLLESLEISDNYLVGEIPVGITKLTKLRMLELYNNQLSGIIPV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_017256
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_017256
LocationChr03:144407820-144411075 (-)
DescriptionSimilar to RLK7: Receptor-like protein kinase 7
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g09970 Plays a role in pattern-triggered immunity (PTI) signaling induced by pathogen-associated molecular patterns (PAMPs).
RLK7, a leucine-rich repeat receptor-like kinase, is required for proper germination speed and tolerance to oxidative stress in Arabidopsis thaliana.2010 · DOI: 10.1007/s00425-010-1260-4
The secreted peptide PIP1 amplifies immunity through receptor-like kinase 7.2014 · DOI: 10.1371/journal.ppat.1004331
At3g19700 Modulates the seed size by negatively regulating the cellularization of syncytial endosperm.
MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis.2005 · DOI: 10.1073/pnas.0508418102
At5g49660 Receptor kinase involved in the perception of C-terminally encoded plant signaling peptide (CEP) and subsequent regulation of root and shoot development.
XYLEM INTERMIXED WITH PHLOEM1, a leucine-rich repeat receptor-like kinase required for stem growth and vascular development in Arabidopsis thaliana.2012 · DOI: 10.1007/s00425-011-1489-6
CEP5 and XIP1/CEPR1 regulate lateral root initiation in Arabidopsis.2016 · DOI: 10.1093/jxb/erw231
At1g28440 Receptor-like protein kinase HSL1. No verified direct reference in this release
At1g72180 Receptor kinase involved in the perception of C-terminally encoded plant signaling peptide (CEP) and subsequent regulation of root and shoot development. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017256 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0006970 response to osmotic stress Biological Process
GO:0006979 response to oxidative stress Biological Process
GO:0009845 seed germination Biological Process
GO:0009960 endosperm development Biological Process
GO:0010051 xylem and phloem pattern formation Biological Process
GO:0010311 lateral root formation Biological Process
GO:0010555 response to mannitol Biological Process
GO:0031540 regulation of anthocyanin biosynthetic process Biological Process
GO:0045087 innate immune response Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0048437 floral organ development Biological Process
KEGG gene cross-reference
ath:AT1G09970
ath:AT1G28440
ath:AT1G72180
ath:AT3G19700
ath:AT5G49660
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.874
Rank 1 · LXL04_017256 · OH-1004
Endoplasmic reticulum0.086
Rank 2 · LXL04_017256 · OH-1004
Cytoplasm0.059
Rank 3 · LXL04_017256 · OH-1004
Nucleus0.034
Rank 4 · LXL04_017256 · OH-1004
Lysosome / Vacuole0.028
Rank 5 · LXL04_017256 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_230-69 aa
PF23598.2LRR_14190-296 aa
PF13855.13LRR_8194-254 aa
PF13855.13LRR_8220-278 aa
PF12799.14LRR_4242-287 aa
PF23598.2LRR_14447-538 aa
PF13855.13LRR_8506-564 aa
PF00069.32Pkinase669-950 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_017256PF08263.18LRRNT_230698e-0626.8
LXL04_017256PF23598.2LRR_141902962.9e-2796.1
LXL04_017256PF13855.13LRR_81942544.9e-2381.4
LXL04_017256PF13855.13LRR_82202784.9e-2381.4
LXL04_017256PF12799.14LRR_42422876.8e-2277.7
LXL04_017256PF23598.2LRR_144475382.9e-2796.1
LXL04_017256PF13855.13LRR_85065644.9e-2381.4
LXL04_017256PF00069.32Pkinase6699501.4e-43149.9
LXL04_017256PF07714.24PK_Tyr_Ser-Thr6719523.3e-37128.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4I2N7Arabidopsis thalianaReceptor-like protein kinase 755.870%Swiss-Protstrong database homology
Q9LJM4Arabidopsis thalianaReceptor-like protein kinase HAIKU255.005%Swiss-Protstrong database homology
Q9FGL5Arabidopsis thalianaReceptor protein-tyrosine kinase CEPR140.144%Swiss-Protmoderate database homology
Q9SGP2Arabidopsis thalianaReceptor-like protein kinase HSL140.580%Swiss-Protmoderate database homology
Q9C7T7Arabidopsis thalianaReceptor protein-tyrosine kinase CEPR240.885%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser