LXL04_016981 | RubberDandelionOmics

Gene overview

LXL04_016981

Reference: OH-1004 Chr: Chr03 Coordinates: 138339805-138342337 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · LXL04_016981|LXL04_016981|OH1004|cDNA

ATGAACCGCTACTGCACGCACGCCACGGCTACTGATCTCAATCGACGCCTCCATCCCCTCGCGATTCCACCTCCGGCTGTTTGGCTGTGTGATTTTATACCGATAACACGGGGTGTTTGGCTGTGTGATTTTATACCGACTTCTTCCTCCTCTGCTGCCATTCTCAAAACAGCGAAACGGATTCAACGAGAGACCACATCAGGTAATCAGGTTCCACACGCATCTCGCACCACCGCTACTGCACGCACGCCTTCATTTTA...

CDS

Download CDS FASTA

1161 bp · LXL04_016981|LXL04_016981|OH1004|CDS

ATGAACCGCTACTGCACGCACGCCACGGCTACTGATCTCAATCGACGCCTCCATCCCCTCGCGATTCCACCTCCGGCTGTTTGGCTGTGTGATTTTATACCGATAACACGGGGTGTTTGGCTGTGTGATTTTATACCGACTTCTTCCTCCTCTGCTGCCATTCTCAAAACAGCGAAACGGATTCAACGAGAGACCACATCAGGTAATCAGGTTCCACACGCATCTCGCACCACCGCTACTGCACGCACGCCTTCATTTTA...

Protein

Download Protein FASTA

386 aa · LXL04_016981|LXL04_016981|OH1004|PROTEIN

MNRYCTHATATDLNRRLHPLAIPPPAVWLCDFIPITRGVWLCDFIPTSSSSAAILKTAKRIQRETTSGNQVPHASRTTATARTPSFYSKKEDEEKAREKELNELFKIAVVQPKVPPGRFCIDFDLLCAKGFKCKFSHDLNVQRKGEKIDIFGDKRDGEDTMEEWDQEMLEKFQVVNVGLPVFSIHGNHDDPAVVDNLSAVDILSACNLVNYFGKMVLGGSGVGGSRTKAGAIRCKKDFMTKSTLGQQQMRFMVPVWSCAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016981`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016981

Location Chr03:138339805-138342337 (-)

Description Similar to At2g20280: Zinc finger CCCH domain-containing protein 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20280`	Zinc finger CCCH domain-containing protein 21.	No verified direct reference in this release
`At5g54260`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0834700`	Zinc finger CCCH domain-containing protein 11.	No verified direct reference in this release
`Os04g0635900`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`UniProt: Q25AA3`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016981 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0002181 cytoplasmic translation Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process

GO:0042138 meiotic DNA double-strand break formation Biological Process

GO:0097552 mitochondrial double-strand break repair via homologous recombination Biological Process

GO:0000785 chromatin Cellular Component

GO:0000791 euchromatin Cellular Component

GO:0000795 synaptonemal complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G20280

ath:AT5G54260

dosa:Os01g0834700

dosa:Os04g0635900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.408

Rank 1 · LXL04_016981 · OH-1004

Nucleus0.402

Rank 2 · LXL04_016981 · OH-1004

Mitochondrion0.136

Rank 3 · LXL04_016981 · OH-1004

Cell membrane0.087

Rank 4 · LXL04_016981 · OH-1004

Endoplasmic reticulum0.074

Rank 5 · LXL04_016981 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SK74`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 21	64.198%	Swiss-Prot	weak database homology
`Q9XGM2`	Arabidopsis thaliana	Double-strand break repair protein MRE11	95.833%	Swiss-Prot	weak database homology
`Q0JHZ2`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 11	68.831%	Swiss-Prot	weak database homology
`Q7XQR9`	Oryza sativa subsp. japonica	Double-strand break repair protein MRE11	54.839%	Swiss-Prot	weak database homology
`Q25AA3`	Oryza sativa subsp. indica	Double-strand break repair protein MRE11	54.839%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card