LXL04_016947 | RubberDandelionOmics

Gene overview

LXL04_016947

Reference: OH-1004 Chr: Chr03 Coordinates: 137407567-137417704 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2316 bp · LXL04_016947|LXL04_016947|OH1004|cDNA

ATGGCTAAATCCTCGATTTCTTTCTCCCAAAATAATATGACGATTTCAGTTTCAGCCATTGTTGCCTTTATTCTCGTACTTACATTAGTTCCTTCTTCAAAAGCTTTGAAACGAATTACGATGGGTAAGGGTGTGTTTGGTTCTGATCAAGCTCTGTATGGAGATGACAGGACTAGATCTCCACCCTCGCTTCTTCAATGGCTGCTCGATCAATTGGCTCGCGTTGAACATCGAAGGTACATAGCAATGAAGCGAAAACG...

CDS

Download CDS FASTA

2316 bp · LXL04_016947|LXL04_016947|OH1004|CDS

ATGGCTAAATCCTCGATTTCTTTCTCCCAAAATAATATGACGATTTCAGTTTCAGCCATTGTTGCCTTTATTCTCGTACTTACATTAGTTCCTTCTTCAAAAGCTTTGAAACGAATTACGATGGGTAAGGGTGTGTTTGGTTCTGATCAAGCTCTGTATGGAGATGACAGGACTAGATCTCCACCCTCGCTTCTTCAATGGCTGCTCGATCAATTGGCTCGCGTTGAACATCGAAGGTACATAGCAATGAAGCGAAAACG...

Protein

Download Protein FASTA

771 aa · LXL04_016947|LXL04_016947|OH1004|PROTEIN

MAKSSISFSQNNMTISVSAIVAFILVLTLVPSSKALKRITMGKGVFGSDQALYGDDRTRSPPSLLQWLLDQLARVEHRRYIAMKRKRASLKAKLEPPLMKKKHQNTAEVHVINDDSEEREEYPRTSTNIKRGRQEDLEIEKSGYGAMISHPNALSQIIAGVIKEITKDAGGLANLSRSLVGNSISNGQMRQPNADMDILEENESQYHQNVECKQEELNAALKVIKKTMKLEAADPFNKPVDPIALGIPDYFDVIKTPMDF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016947`
TK1151 ID	TkA02G090960
OH-1004 ID	LXL04_016947
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.900
Protein coverage (%)	TK1151 100.000 / OH-1004 89.364 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016947

Location Chr03:137407567-137417704 (+)

Description Similar to BDF2: Bromodomain-containing factor 2 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q9FGW9`	Acts as a negative regulator in plant response to changes in environmental conditions through the control of ABA-regulated gene expression.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016947 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0030435 sporulation resulting in formation of a cellular spore Biological Process

GO:0031452 negative regulation of heterochromatin formation Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

KEGG gene cross-reference

hsa:23476

mmu:57261

sce:YDL070W

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · LXL04_016947 · OH-1004

Cytoplasm0.096

Rank 2 · LXL04_016947 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_016947 · OH-1004

Mitochondrion0.013

Rank 4 · LXL04_016947 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_016947 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00439.31Bromodomain221-304 aa

PF03004.20Transposase_24520-640 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016947	`PF00439.31`	Bromodomain	221	304	6.5e-18	65.2
LXL04_016947	`PF03004.20`	Transposase_24	520	640	6.4e-23	82.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGW9`	Arabidopsis thaliana	Transcription factor GTE10	38.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card