LXL04_016789 | RubberDandelionOmics

Gene overview

LXL04_016789

Reference: OH-1004 Chr: Chr03 Coordinates: 133756017-133760880 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1836 bp · LXL04_016789|LXL04_016789|OH1004|cDNA

ATGTCTCTCTCACGGTTTCATGCTCTTTCACGTCAGAAGATCCTCTACAGCTTTCGTATCACTCCTCTTCTATATAGAAATCCAATCCACCGCTCAATAAAAGATGAACATTCATTTTCTTTACAGCTCAATAAAGGCTCACATTTCCGTCATTCTACTTTCGAAAATAGACATTGGTTTTCTACAGTTCGTGCTCATGATGATGTAAGCTTTGAAATCAGAGACTCTTGTGCTGATTCCAATGAGATTCAGTTACCTGT...

CDS

Download CDS FASTA

1836 bp · LXL04_016789|LXL04_016789|OH1004|CDS

ATGTCTCTCTCACGGTTTCATGCTCTTTCACGTCAGAAGATCCTCTACAGCTTTCGTATCACTCCTCTTCTATATAGAAATCCAATCCACCGCTCAATAAAAGATGAACATTCATTTTCTTTACAGCTCAATAAAGGCTCACATTTCCGTCATTCTACTTTCGAAAATAGACATTGGTTTTCTACAGTTCGTGCTCATGATGATGTAAGCTTTGAAATCAGAGACTCTTGTGCTGATTCCAATGAGATTCAGTTACCTGT...

Protein

Download Protein FASTA

611 aa · LXL04_016789|LXL04_016789|OH1004|PROTEIN

MSLSRFHALSRQKILYSFRITPLLYRNPIHRSIKDEHSFSLQLNKGSHFRHSTFENRHWFSTVRAHDDVSFEIRDSCADSNEIQLPVSSFANGKPVEFSKVDARLLPTVLLIGRPNVGKSALFNRLIRRREALVYNTPNDHVTRDIREGIAKLGDLRFKVLDSAGLEAEASSGSVLGRTAEMTANVLRMSSLALFLIDARDGLQPMDLDVGKWLRKHAPGIKIVMVMNKAESLDDGIGSVDFAANEARMLGFGDPIALSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016789`
TK1151 ID	TkA02G102500
OH-1004 ID	LXL04_016789
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.000
Protein coverage (%)	TK1151 69.271 / OH-1004 21.113 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_016789`
Location	Chr03:133756017-133760880 (+)
Description	Similar to der: GTPase Der (Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016789` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0042254 ribosome biogenesis Biological Process GO:0005525 GTP binding Molecular Function
KEGG gene cross-reference	bbt:BBta_3776 jan:Jann_2169 mag:amb1344 pde:Pden_2427 pla:Plav_3492 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.593

Rank 1 · LXL04_016789 · OH-1004

Mitochondrion0.348

Rank 2 · LXL04_016789 · OH-1004

Nucleus0.055

Rank 3 · LXL04_016789 · OH-1004

Cytoplasm0.037

Rank 4 · LXL04_016789 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_016789 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02421.25FeoB_N108-166 aa

PF01926.30MMR_HSR1109-229 aa

PF02421.25FeoB_N310-482 aa

PF01926.30MMR_HSR1311-434 aa

PF04548.23AIG1311-468 aa

PF00350.30Dynamin_N311-358 aa

PF00009.34GTP_EFTU312-488 aa

PF14714.12KH_dom-like494-573 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016789	`PF02421.25`	FeoB_N	108	166	1.1e-16	61.5
LXL04_016789	`PF01926.30`	MMR_HSR1	109	229	1e-42	145.5
LXL04_016789	`PF02421.25`	FeoB_N	310	482	1.1e-16	61.5
LXL04_016789	`PF01926.30`	MMR_HSR1	311	434	1e-42	145.5
LXL04_016789	`PF04548.23`	AIG1	311	468	2.4e-09	37.5
LXL04_016789	`PF00350.30`	Dynamin_N	311	358	3.4e-07	31.2
LXL04_016789	`PF00009.34`	GTP_EFTU	312	488	8.9e-16	58.7
LXL04_016789	`PF14714.12`	KH_dom-like	494	573	3.8e-20	72.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card