LXL04_016610 | RubberDandelionOmics

Gene overview

LXL04_016610

Reference: OH-1004 Chr: Chr03 Coordinates: 128794720-128801690 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1953 bp · LXL04_016610|LXL04_016610|OH1004|cDNA

ATGGCTTTCTCTTACATGAAGATGATGAACAGTGGGTGCATCCATGGTTCGAACCCATCGCGCTTGTTTCTGGGGACATCAACGCCGTTTAGTTCACTTAAGTCGAACCCGAACCCGAATTCGAGCCCGAGTAACAAAAACCGGGTCCAAATCCCCCTCGCCAGTCATCGCGCCTCTTCATATGTTGCTTCTTTAGCTGCTTTTGCTGTGCTCACCCGAAGTGTCGCTAATGATGTTCTAACCGTCGGTAAAGAACTTCG...

CDS

Download CDS FASTA

1953 bp · LXL04_016610|LXL04_016610|OH1004|CDS

ATGGCTTTCTCTTACATGAAGATGATGAACAGTGGGTGCATCCATGGTTCGAACCCATCGCGCTTGTTTCTGGGGACATCAACGCCGTTTAGTTCACTTAAGTCGAACCCGAACCCGAATTCGAGCCCGAGTAACAAAAACCGGGTCCAAATCCCCCTCGCCAGTCATCGCGCCTCTTCATATGTTGCTTCTTTAGCTGCTTTTGCTGTGCTCACCCGAAGTGTCGCTAATGATGTTCTAACCGTCGGTAAAGAACTTCG...

Protein

Download Protein FASTA

650 aa · LXL04_016610|LXL04_016610|OH1004|PROTEIN

MAFSYMKMMNSGCIHGSNPSRLFLGTSTPFSSLKSNPNPNSSPSNKNRVQIPLASHRASSYVASLAAFAVLTRSVANDVLTVGKELRTLADEFIPREYQDYYIHEMKKILRNKDAEFTIVIDEYQAQSNTADEMFKAVETYLGTKVNESCIRKVNVCKNKEMLSVRMNKDEEIIDEYDGVQVKWRSTTKTGFGEVQSWLKSYELTFHNRHRYKILESYFPYILERCDEIKANESGLKLHMIDDGYHESKTIVIDNPMTFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016610`
TK1151 ID	TkAUNG039440
OH-1004 ID	LXL04_016610
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 75.538 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016610

Location Chr03:128794720-128801690 (-)

Description Similar to At3g50940: AAA-ATPase At3g50940

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50940`	AAA-ATPase At3g50940.	No verified direct reference in this release
`At3g50930`	Protein HYPER-SENSITIVITY-RELATED 4.	No verified direct reference in this release
`At1g16890`	Catalyzes the synthesis of non-canonical poly-ubiquitin chains that are linked through 'Lys-63'.	Arabidopsis thaliana UBC13: implication of error-free DNA damage tolerance and Lys63-linked polyubiquitylation in plants.2006 · DOI: 10.1007/s11103-006-0007-x A lysine-63-linked ubiquitin chain-forming conjugase, UBC13, promotes the developmental responses to iron deficiency in Arabidopsis roots.2010 · DOI: 10.1111/j.1365-313x.2010.04150.x
`At1g78870`	Catalyzes the synthesis of non-canonical poly-ubiquitin chains that are linked through 'Lys-63'.	Arabidopsis thaliana UBC13: implication of error-free DNA damage tolerance and Lys63-linked polyubiquitylation in plants.2006 · DOI: 10.1007/s11103-006-0007-x A lysine-63-linked ubiquitin chain-forming conjugase, UBC13, promotes the developmental responses to iron deficiency in Arabidopsis roots.2010 · DOI: 10.1111/j.1365-313x.2010.04150.x
`At5g17760`	AAA-ATPase At5g17760.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016610 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006301 DNA damage tolerance Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006950 response to stress Biological Process

GO:0009411 response to UV Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0010039 response to iron ion Biological Process

GO:0010053 root epidermal cell differentiation Biological Process

GO:0012501 programmed cell death Biological Process

KEGG gene cross-reference

ath:AT1G16890

ath:AT1G78870

ath:AT3G50930

ath:AT3G50940

ath:AT5G17760

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.298

Rank 1 · LXL04_016610 · OH-1004

Mitochondrion0.197

Rank 2 · LXL04_016610 · OH-1004

Nucleus0.180

Rank 3 · LXL04_016610 · OH-1004

Plastid0.131

Rank 4 · LXL04_016610 · OH-1004

Endoplasmic reticulum0.126

Rank 5 · LXL04_016610 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14363.12AAA_assoc94-187 aa

PF00004.36AAA298-421 aa

PF25568.1AAA_lid_At3g28540423-488 aa

PF00179.32UQ_con506-642 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016610	`PF14363.12`	AAA_assoc	94	187	4.1e-18	66.3
LXL04_016610	`PF00004.36`	AAA	298	421	2.7e-17	64.2
LXL04_016610	`PF25568.1`	AAA_lid_At3g28540	423	488	9.3e-21	74.3
LXL04_016610	`PF00179.32`	UQ_con	506	642	2.6e-49	167.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q147F9`	Arabidopsis thaliana	AAA-ATPase At3g50940	41.330%	Swiss-Prot	moderate database homology
`Q8VZG2`	Arabidopsis thaliana	Protein HYPER-SENSITIVITY-RELATED 4	40.233%	Swiss-Prot	moderate database homology
`Q9FZ48`	Arabidopsis thaliana	Ubiquitin-conjugating enzyme E2 36	97.386%	Swiss-Prot	weak database homology
`Q94A97`	Arabidopsis thaliana	Ubiquitin-conjugating enzyme E2 35	96.078%	Swiss-Prot	weak database homology
`Q9FN75`	Arabidopsis thaliana	AAA-ATPase At5g17760	39.171%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card