LXL04_016536 | RubberDandelionOmics

Gene overview

LXL04_016536

Reference: OH-1004 Chr: Chr03 Coordinates: 126101341-126104461 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1179 bp · LXL04_016536|LXL04_016536|OH1004|cDNA

ATGACTTCAGGTTTGGAACCGGCGTGCTGCTCTACAATCAACGCAACTGATCACAACATCCTTCAAAGTCGTGCATCCTCCACATACCTTTCAATCCCCGGTTACCTTTGGGGTTTACCGGATTCGGTGTCGTTTCCATCCGAATCTTCACCTGCTACGTCGTCTTTTCAAATCCTCATGTTCTGGTTTCTGTGGTCGTTTGGCTTTCACTACTCAGGTTACTACTCGAACTGTCTATTTGCTGGAGGTGACAGGAAAGA...

CDS

Download CDS FASTA

1179 bp · LXL04_016536|LXL04_016536|OH1004|CDS

ATGACTTCAGGTTTGGAACCGGCGTGCTGCTCTACAATCAACGCAACTGATCACAACATCCTTCAAAGTCGTGCATCCTCCACATACCTTTCAATCCCCGGTTACCTTTGGGGTTTACCGGATTCGGTGTCGTTTCCATCCGAATCTTCACCTGCTACGTCGTCTTTTCAAATCCTCATGTTCTGGTTTCTGTGGTCGTTTGGCTTTCACTACTCAGGTTACTACTCGAACTGTCTATTTGCTGGAGGTGACAGGAAAGA...

Protein

Download Protein FASTA

392 aa · LXL04_016536|LXL04_016536|OH1004|PROTEIN

MTSGLEPACCSTINATDHNILQSRASSTYLSIPGYLWGLPDSVSFPSESSPATSSFQILMFWFLWSFGFHYSGYYSNCLFAGGDRKDVFFYQADDQHYIPRALLMDLEPRVVNGIQTGEYRNLYNHENIFTSKEGGGAGNNWASGYHQGKNFEEDLMDMIDREADGSDSLKGFVLCHSIAGGAGSGMGSYLLETLNDRYSKKLVQTYSVFPNQNETSDVVVQPYNSLLTLKRLTLNADCVVVLDNTALRIAVERLHIQNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016536`
TK1151 ID	TkA01G379290
OH-1004 ID	LXL04_016536
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	75.000
Protein coverage (%)	TK1151 17.021 / OH-1004 8.163 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016536

Location Chr03:126101341-126104461 (+)

Description Similar to TUBG1: Tubulin gamma-1 chain

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61650`	Tubulin is the major constituent of microtubules.	Feeding cells induced by phytoparasitic nematodes require γ-tubulin ring complex for microtubule reorganization.2011 · DOI: 10.1371/journal.ppat.1002343
`At5g05620`	Tubulin is the major constituent of microtubules.	Feeding cells induced by phytoparasitic nematodes require γ-tubulin ring complex for microtubule reorganization.2011 · DOI: 10.1371/journal.ppat.1002343

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0156600`	Tubulin is the major constituent of microtubules.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016536 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000070 mitotic sister chromatid segregation Biological Process

GO:0000212 meiotic spindle organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007020 microtubule nucleation Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0009624 response to nematode Biological Process

GO:0010103 stomatal complex morphogenesis Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0046785 microtubule polymerization Biological Process

GO:0048366 leaf development Biological Process

GO:0048768 root hair cell tip growth Biological Process

KEGG gene cross-reference

ath:AT3G61650

ath:AT5G05620

dosa:Os05g0156600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.418

Rank 1 · LXL04_016536 · OH-1004

Mitochondrion0.247

Rank 2 · LXL04_016536 · OH-1004

Peroxisome0.145

Rank 3 · LXL04_016536 · OH-1004

Nucleus0.141

Rank 4 · LXL04_016536 · OH-1004

Plastid0.072

Rank 5 · LXL04_016536 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00091.32Tubulin84-248 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016536	`PF00091.32`	Tubulin	84	248	7.7e-46	157.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P38557`	Arabidopsis thaliana	Tubulin gamma-1 chain	69.095%	Swiss-Prot	strong database homology
`P38558`	Arabidopsis thaliana	Tubulin gamma-2 chain	69.095%	Swiss-Prot	strong database homology
`O49068`	Oryza sativa subsp. japonica	Tubulin gamma-2 chain	67.920%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card