LXL04_016294 | RubberDandelionOmics

Gene overview

LXL04_016294

Reference: OH-1004 Chr: Chr03 Coordinates: 117650200-117657583 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2271 bp · LXL04_016294|LXL04_016294|OH1004|cDNA

ATGTTTggtgttttccggcgaagaGTTGTTAGCGGAAGCTCCACTGCTTCGGTGTTACTCCATCCAAGAACTGTTGGAAAAGATCAAAGTTTATGCCATACTGTCCAAAGTGGTGCAGTGAATTTAAGGCCATTAAGGAAAGTTATGACCAGTCTTAAGCCATGTGTCAGCATGCAAATGCAATCCAGAATGTTCTCCTCTGACAGTGgTGACCTGGTTGATGTTGCTGTCCCTTTTATGGGTGAATCTATAAGTGATGG...

CDS

Download CDS FASTA

2271 bp · LXL04_016294|LXL04_016294|OH1004|CDS

ATGTTTGGTGTTTTCCGGCGAAGAGTTGTTAGCGGAAGCTCCACTGCTTCGGTGTTACTCCATCCAAGAACTGTTGGAAAAGATCAAAGTTTATGCCATACTGTCCAAAGTGGTGCAGTGAATTTAAGGCCATTAAGGAAAGTTATGACCAGTCTTAAGCCATGTGTCAGCATGCAAATGCAATCCAGAATGTTCTCCTCTGACAGTGGTGACCTGGTTGATGTTGCTGTCCCTTTTATGGGTGAATCTATAAGTGATGG...

Protein

Download Protein FASTA

756 aa · LXL04_016294|LXL04_016294|OH1004|PROTEIN

MFGVFRRRVVSGSSTASVLLHPRTVGKDQSLCHTVQSGAVNLRPLRKVMTSLKPCVSMQMQSRMFSSDSGDLVDVAVPFMGESISDGTLATFLKKPGEMVEVNEPIAQVKTDKVTINVDSPEAGVIQEFVANEGDTVESGTKIAIISKFAAASPPPPKDETTPGGIKEEMKEMKKKMDEILDNLAVRKEMKEMKKELESDALVMEWLHVAIEDAVATSLFMEQKLEGGKLIFLISFYDYDVIFWPILLVEGLCSLSRYWG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016294`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016294

Location Chr03:117650200-117657583 (+)

Description Similar to At4g26910: Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26910`	The 2-oxoglutarate dehydrogenase complex catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2).	No verified direct reference in this release
`At5g55070`	The 2-oxoglutarate dehydrogenase complex catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016294 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006103 2-oxoglutarate metabolic process Biological Process

GO:0006104 succinyl-CoA metabolic process Biological Process

GO:0033512 L-lysine catabolic process to acetyl-CoA via L-saccharopine Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0045252 oxoglutarate dehydrogenase complex Cellular Component

GO:0004149 dihydrolipoyllysine-residue succinyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G26910

ath:AT5G55070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.666

Rank 1 · LXL04_016294 · OH-1004

Plastid0.309

Rank 2 · LXL04_016294 · OH-1004

Cytoplasm0.070

Rank 3 · LXL04_016294 · OH-1004

Peroxisome0.028

Rank 4 · LXL04_016294 · OH-1004

Nucleus0.027

Rank 5 · LXL04_016294 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00364.29Biotin_lipoyl74-146 aa

PF25919.1BSH_CusB93-146 aa

PF00364.29Biotin_lipoyl392-461 aa

PF25997.1BSH_YhbJ400-459 aa

PF25919.1BSH_CusB409-461 aa

PF00198.292-oxoacid_dh526-754 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016294	`PF00364.29`	Biotin_lipoyl	74	146	1.9e-32	111.7
LXL04_016294	`PF25919.1`	BSH_CusB	93	146	7.9e-14	52.0
LXL04_016294	`PF00364.29`	Biotin_lipoyl	392	461	1.9e-32	111.7
LXL04_016294	`PF25997.1`	BSH_YhbJ	400	459	6.9e-11	42.8
LXL04_016294	`PF25919.1`	BSH_CusB	409	461	7.9e-14	52.0
LXL04_016294	`PF00198.29`	2-oxoacid_dh	526	754	1.6e-82	277.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H107`	Arabidopsis thaliana	Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 2, mitochondrial	69.848%	Swiss-Prot	moderate database homology
`Q9FLQ4`	Arabidopsis thaliana	Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1, mitochondrial	68.856%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card