LXL04_016288 | RubberDandelionOmics

Gene overview

LXL04_016288

Reference: OH-1004 Chr: Chr03 Coordinates: 117391258-117392424 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1019 bp · LXL04_016288|LXL04_016288|OH1004|cDNA

TTGAGTAACAGGCAGGTTTTGCCGGTGACGAAGCTCCCAAAGCCATGTTCCCCAGTGTTGTGGGTAGGCCACAAGACAGTGGCTCTATGGTGGATGGAAAAGATGCTCATGTAGGAGATGGTTCCATGTCGAGAAGTGGTATCTTGACTTTGAAATACCCTATTGAACATGGTATTATCTGCAACTCGGACGATATGGAAAAGCTTTGGCATCACACTTATACCGAGCTTCAAGTTTCTACTGAAGAGCGACCCGTGCTC...

CDS

Download CDS FASTA

975 bp · LXL04_016288|LXL04_016288|OH1004|CDS

ATGTTCCCCAGTGTTGTGGGTAGGCCACAAGACAGTGGCTCTATGGTGGATGGAAAAGATGCTCATGTAGGAGATGGTTCCATGTCGAGAAGTGGTATCTTGACTTTGAAATACCCTATTGAACATGGTATTATCTGCAACTCGGACGATATGGAAAAGCTTTGGCATCACACTTATACCGAGCTTCAAGTTTCTACTGAAGAGCGACCCGTGCTCCTTACTGAGGCATTACTAAATCCTAAGACAAACAAAGAAAAGAC...

Protein

Download Protein FASTA

324 aa · LXL04_016288|LXL04_016288|OH1004|PROTEIN

MFPSVVGRPQDSGSMVDGKDAHVGDGSMSRSGILTLKYPIEHGIICNSDDMEKLWHHTYTELQVSTEERPVLLTEALLNPKTNKEKTTQIMFETFNIPAIYFGIQPVLSLCASGRTTGLVLHSGDSVSDIVPIYEDYAIPHAAHCLNFGGRELTDFLMKSLTERGYMFTTTAERENIRDMKEKCAYVALDYDQELQTAKSSSSIEKKYQLLDGQAITIGVERFRCPEALFHPSLIGMEDVVGIHKMTHNSIMKCDVDMRK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016288`
TK1151 ID	TkA02G161860
OH-1004 ID	LXL04_016288
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.600
Protein coverage (%)	TK1151 99.153 / OH-1004 36.111 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016288

Location Chr03:117391258-117392424 (+)

Description Similar to ACT7: Actin-7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g09810`	Actins are highly conserved proteins that are involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells.	One plant actin isovariant, ACT7, is induced by auxin and required for normal callus formation.2001 · DOI: 10.1105/tpc.010026 A Framework for Lateral Membrane Trafficking and Polar Tethering of the PEN3 ATP-Binding Cassette Transporter.2016 · DOI: 10.1104/pp.16.01252

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016288 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006893 Golgi to plasma membrane transport Biological Process

GO:0008104 intracellular protein localization Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009611 response to wounding Biological Process

GO:0009653 anatomical structure morphogenesis Biological Process

GO:0009733 response to auxin Biological Process

GO:0009845 seed germination Biological Process

GO:0010053 root epidermal cell differentiation Biological Process

GO:0015031 protein transport Biological Process

GO:0048364 root development Biological Process

GO:0048468 cell development Biological Process

GO:0048731 system development Biological Process

KEGG gene cross-reference

ath:AT5G09810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.733

Rank 1 · LXL04_016288 · OH-1004

Nucleus0.307

Rank 2 · LXL04_016288 · OH-1004

Mitochondrion0.058

Rank 3 · LXL04_016288 · OH-1004

Cell membrane0.045

Rank 4 · LXL04_016288 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_016288 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00022.27Actin1-323 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016288	`PF00022.27`	Actin	1	323	1.5e-94	317.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P53492`	Arabidopsis thaliana	Actin-7	72.477%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card