LXL04_016276 | RubberDandelionOmics

Gene overview

LXL04_016276

Reference: OH-1004 Chr: Chr03 Coordinates: 117091387-117095788 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3888 bp · LXL04_016276|LXL04_016276|OH1004|cDNA

ATGACTGGGGCTATCGACGAGGCAATGATCGGGAATGATGTGTGTGATCTTGAACGCCGTTCTCCGTTGTTCTTCTTATTTGAATCTCTTATTTTGGTCAATCCAACTGGACCCTCTTTTGGAAATCTCATTCACGACGATGGCCATAGTGGAGAGAGGGGGAAGCGAGATTATGCCAGGAAGGTGGTTGCGGAAAGAGGCGGCAACGAAGGGAGTGACGATATAATCTTATCATATTATTTAACCAAACAAGTGGCTTT...

CDS

Download CDS FASTA

3888 bp · LXL04_016276|LXL04_016276|OH1004|CDS

ATGACTGGGGCTATCGACGAGGCAATGATCGGGAATGATGTGTGTGATCTTGAACGCCGTTCTCCGTTGTTCTTCTTATTTGAATCTCTTATTTTGGTCAATCCAACTGGACCCTCTTTTGGAAATCTCATTCACGACGATGGCCATAGTGGAGAGAGGGGGAAGCGAGATTATGCCAGGAAGGTGGTTGCGGAAAGAGGCGGCAACGAAGGGAGTGACGATATAATCTTATCATATTATTTAACCAAACAAGTGGCTTT...

Protein

Download Protein FASTA

1295 aa · LXL04_016276|LXL04_016276|OH1004|PROTEIN

MTGAIDEAMIGNDVCDLERRSPLFFLFESLILVNPTGPSFGNLIHDDGHSGERGKRDYARKVVAERGGNEGSDDIILSYYLTKQVAFVSPPTPIESSNKDIALTLQVLELTILFNIEFISSKFLCNRFIQTFPNKDKILSRIPSMASSSASYVAKSFKYDVFLSFRGEDTRKNFIAHLYNALLKRNINTYKDDEEIKKGKGISDELIRSIEESKFFIIVFSKNYASSSWCLDELVNIMECHKTTGHTVYPIFYDVEPCEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016276`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016276

Location Chr03:117091387-117095788 (-)

Description Similar to RUN1: Disease resistance protein RUN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44510`	TIR-NB-LRR receptor-like protein that contributes to disease resistance induced by the Pseudomonas syringae type III effector AvrB.	Arabidopsis TAO1 is a TIR-NB-LRR protein that contributes to disease resistance induced by the Pseudomonas syringae effector AvrB.2008 · DOI: 10.1073/pnas.0802157105

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016276 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0019677 NAD+ catabolic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003953 NAD+ nucleosidase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G44510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.403

Rank 1 · LXL04_016276 · OH-1004

Nucleus0.286

Rank 2 · LXL04_016276 · OH-1004

Cell membrane0.245

Rank 3 · LXL04_016276 · OH-1004

Endoplasmic reticulum0.113

Rank 4 · LXL04_016276 · OH-1004

Lysosome / Vacuole0.055

Rank 5 · LXL04_016276 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01582.26TIR158-322 aa

PF13676.12TIR_2161-259 aa

PF00931.29NB-ARC338-505 aa

PF23282.2WHD_ROQ1574-646 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016276	`PF01582.26`	TIR	158	322	5.3e-49	167.1
LXL04_016276	`PF13676.12`	TIR_2	161	259	4.1e-16	60.3
LXL04_016276	`PF00931.29`	NB-ARC	338	505	1e-19	71.5
LXL04_016276	`PF23282.2`	WHD_ROQ1	574	646	3e-09	37.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FI14`	Arabidopsis thaliana	Disease resistance protein TAO1	30.640%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card