LXL04_015863 | RubberDandelionOmics

Gene overview

LXL04_015863

Reference: OH-1004 Chr: Chr03 Coordinates: 93016159-93019176 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · LXL04_015863|LXL04_015863|OH1004|cDNA

ATGCCTTTAAATGCATCTATACATCCAATCACGCCCTTGAGGGGGAGTGGGGAGTTGTTTACGCCATTGAGGGGGGTGGGAAGACTGTTCACGCCATTGAGGGGTAGTGGGAAGTTGTTTACGCCCTTGGGGGGGAGTGggaaggctgttcacgcccttgggGAGTGGGAAGACTGTTCACGCCCTTGGGGGGGAGTGggaaggctgttcacgcccttcGGGGAATTTGAGGGTTCAGCCTCGATCCGCTTGCACAGCCA...

CDS

Download CDS FASTA

1161 bp · LXL04_015863|LXL04_015863|OH1004|CDS

ATGCCTTTAAATGCATCTATACATCCAATCACGCCCTTGAGGGGGAGTGGGGAGTTGTTTACGCCATTGAGGGGGGTGGGAAGACTGTTCACGCCATTGAGGGGTAGTGGGAAGTTGTTTACGCCCTTGGGGGGGAGTGGGAAGGCTGTTCACGCCCTTGGGGAGTGGGAAGACTGTTCACGCCCTTGGGGGGGAGTGGGAAGGCTGTTCACGCCCTTCGGGGAATTTGAGGGTTCAGCCTCGATCCGCTTGCACAGCCA...

Protein

Download Protein FASTA

386 aa · LXL04_015863|LXL04_015863|OH1004|PROTEIN

MPLNASIHPITPLRGSGELFTPLRGVGRLFTPLRGSGKLFTPLGGSGKAVHALGEWEDCSRPWGGVGRLFTPFGEFEGSASIRLHSHLHLLPCSPSPMARYLTRALLPRWRDAFSDFPLYLPRFEIRIERDAFSDFRSLLLISQFAVNSLTLKLILLDSQSPTPEPSRHHPLAIPPPADLNRRLISIWLCHFIRITTGPFSLYTFAATGTPILLNLHIFTHLKIEGVEKETTRRIKEKETTRVREKTHRPVHTPGSLSPH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015863`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015863

Location Chr03:93016159-93019176 (+)

Description Similar to DRP3A: Dynamin-related protein 3A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g33650`	Involved in the control of mitochondrial and peroxisomal division and morphology.	ADL2a, like ADL2b, is involved in the control of higher plant mitochondrial morphology.2004 · DOI: 10.1093/jxb/erh073 Arabidopsis dynamin-like protein 2a (ADL2a), like ADL2b, is involved in plant mitochondrial division.2004 · DOI: 10.1093/pcp/pch024 Arabidopsis PEROXIN11c-e, FISSION1b, and DYNAMIN-RELATED PROTEIN3A cooperate in cell cycle-associated replication of peroxisomes.2008 · DOI: 10.1105/tpc.107.057679 Two small protein families, DYNAMIN-RELATED PROTEIN3 and FISSION1, are required for peroxisome fission in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2008.03677.x
`At2g14120`	Involved in the control of mitochondrial and peroxisomal division and morphology.	ADL2a, like ADL2b, is involved in the control of higher plant mitochondrial morphology.2004 · DOI: 10.1093/jxb/erh073 Arabidopsis dynamin-like protein 2a (ADL2a), like ADL2b, is involved in plant mitochondrial division.2004 · DOI: 10.1093/pcp/pch024 Two small protein families, DYNAMIN-RELATED PROTEIN3 and FISSION1, are required for peroxisome fission in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2008.03677.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015863 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000266 mitochondrial fission Biological Process

GO:0006897 endocytosis Biological Process

GO:0006907 pinocytosis Biological Process

GO:0006909 phagocytosis Biological Process

GO:0006997 nucleus organization Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0007015 actin filament organization Biological Process

GO:0007032 endosome organization Biological Process

GO:0007163 establishment or maintenance of cell polarity Biological Process

GO:0009617 response to bacterium Biological Process

GO:0016559 peroxisome fission Biological Process

GO:0044375 regulation of peroxisome size Biological Process

KEGG gene cross-reference

ath:AT2G14120

ath:AT4G33650

bta:540892

ddi:DDB_G0277849

tgo:TGME49_267800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.441

Rank 1 · LXL04_015863 · OH-1004

Nucleus0.401

Rank 2 · LXL04_015863 · OH-1004

Mitochondrion0.168

Rank 3 · LXL04_015863 · OH-1004

Endoplasmic reticulum0.073

Rank 4 · LXL04_015863 · OH-1004

Cell membrane0.064

Rank 5 · LXL04_015863 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02212.24GED285-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015863	`PF02212.24`	GED	285	339	2.7e-15	57.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S944`	Arabidopsis thaliana	Dynamin-related protein 3A	61.538%	Swiss-Prot	weak database homology
`Q8LFT2`	Arabidopsis thaliana	Dynamin-related protein 3B	72.857%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card