LXL04_015820 | RubberDandelionOmics

Gene overview

LXL04_015820

Reference: OH-1004 Chr: Chr03 Coordinates: 87346176-87351360 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4533 bp · LXL04_015820|LXL04_015820|OH1004|cDNA

ATGGAGATTAGTGTAGGAAACTCAGCAGGTAGTAATACAAAGTCGTTGGATCTTAAAACACTTTATACATCGGAGGTGAGTAACAAGGGGGAGTCCGTGAAGCAGGAAACAGGTAGTTGGCTGGGAAATGGTGAGGGGGCGGAGACAAAGAAGAGAAAGAGCAGGAAGGAGGTGACAATTAGTAGCTTTGAGGATCTGGCAGAGAGGAAAAGGAGTAAGCATAGCATAGATGATACTGAAGTTGATGGGGATGAGTCATG...

CDS

Download CDS FASTA

4533 bp · LXL04_015820|LXL04_015820|OH1004|CDS

ATGGAGATTAGTGTAGGAAACTCAGCAGGTAGTAATACAAAGTCGTTGGATCTTAAAACACTTTATACATCGGAGGTGAGTAACAAGGGGGAGTCCGTGAAGCAGGAAACAGGTAGTTGGCTGGGAAATGGTGAGGGGGCGGAGACAAAGAAGAGAAAGAGCAGGAAGGAGGTGACAATTAGTAGCTTTGAGGATCTGGCAGAGAGGAAAAGGAGTAAGCATAGCATAGATGATACTGAAGTTGATGGGGATGAGTCATG...

Protein

Download Protein FASTA

1510 aa · LXL04_015820|LXL04_015820|OH1004|PROTEIN

MEISVGNSAGSNTKSLDLKTLYTSEVSNKGESVKQETGSWLGNGEGAETKKRKSRKEVTISSFEDLAERKRSKHSIDDTEVDGDESCSAQSSGLGQKINGGAFNALGINTGDDSHGVLIPKRPRGTVGRNNFDTSHLLNPSAPSDYVEIVTMLTDEPNEVLQVEVTPMDEPCVEQIVKLNDSSGVEDRTNQTGVVDSKVDQMQESTTVTSSPHANNNDADFVSNDEVSRLKLETEEIPQGKVPFPDASLSSNSTSADKTT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015820`
TK1151 ID	TkA02G209960
OH-1004 ID	LXL04_015820
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.900
Protein coverage (%)	TK1151 95.575 / OH-1004 22.517 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015820

Location Chr03:87346176-87351360 (-)

Description Similar to TRX1: Histone-lysine N-methyltransferase TRX1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31880`	Cohesin cofactor dispensable during the meiotic division but playing an important role in DNA repair by homologous recombination (HR) probably by helping SMC5/SMC6 complex.	Involvement of the Cohesin Cofactor PDS5 (SPO76) During Meiosis and DNA Repair in Arabidopsis thaliana.2015 · DOI: 10.3389/fpls.2015.01034
`At2g31650`	May participate in target-gene transcriptional regulation and associated histone methylation.	Combinatorial functions of diverse histone methylations in Arabidopsis thaliana flowering time regulation.2014 · DOI: 10.1111/nph.12493 Arabidopsis homolog of trithorax1 (ATX1) is required for cell production, patterning, and morphogenesis in root development.2014 · DOI: 10.1093/jxb/eru355
`At1g05830`	Histone methyltransferase.	The highly similar Arabidopsis homologs of trithorax ATX1 and ATX2 encode proteins with divergent biochemical functions.2008 · DOI: 10.1105/tpc.107.056614 Combinatorial functions of diverse histone methylations in Arabidopsis thaliana flowering time regulation.2014 · DOI: 10.1111/nph.12493
`At1g15940`	Cohesin cofactor dispensable during the meiotic division but playing an important role in DNA repair by homologous recombination (HR) probably by helping SMC5/SMC6 complex.	Involvement of the Cohesin Cofactor PDS5 (SPO76) During Meiosis and DNA Repair in Arabidopsis thaliana.2015 · DOI: 10.3389/fpls.2015.01034

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0134500`	Possesses histone H3 methyltransferase activity in vitro.	Trithorax group protein Oryza sativa Trithorax1 controls flowering time in rice via interaction with early heading date3.2014 · DOI: 10.1104/pp.113.228049

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015820 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0007064 mitotic sister chromatid cohesion Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

KEGG gene cross-reference

ath:AT1G05830

ath:AT1G15940

ath:AT2G31650

ath:AT4G31880

dosa:Os09g0134500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · LXL04_015820 · OH-1004

Cytoplasm0.078

Rank 2 · LXL04_015820 · OH-1004

Cell membrane0.043

Rank 3 · LXL04_015820 · OH-1004

Endoplasmic reticulum0.024

Rank 4 · LXL04_015820 · OH-1004

Plastid0.017

Rank 5 · LXL04_015820 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10513.15EPL1952-1171 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015820	`PF10513.15`	EPL1	952	1171	5.2e-11	44.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUP3`	Arabidopsis thaliana	Sister chromatid cohesion protein PDS5 homolog C	41.509%	Swiss-Prot	weak database homology
`Q9C5X4`	Arabidopsis thaliana	Histone H3-lysine(4) N-trimethyltransferase ATX1	33.708%	Swiss-Prot	weak database homology
`P0CB22`	Arabidopsis thaliana	Histone-lysine N-methyltransferase ATX2	28.947%	Swiss-Prot	weak database homology
`Q9S9P0`	Arabidopsis thaliana	Sister chromatid cohesion protein PDS5 homolog E	23.967%	Swiss-Prot	weak database homology
`Q6K431`	Oryza sativa subsp. japonica	Histone-lysine N-methyltransferase TRX1	34.444%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card