Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1740 bp · LXL04_015784|LXL04_015784|OH1004|cDNA
ATGGACTTCGACGAGTACGAGTACTTGGAGAAGACAGTCGACGAACCTGACACCAGGAATGGTTCATCCTCGAAGACCAAAGACCGCGGCTCGGAGAAGAGCGAAAAGGGTTACAGGCGGAAGGATAGAGAAGACGATGGCGAGGATGCCGAAAATGACCGCATTGAAGAAGAAGGGAGGAGGAGCAAGAAATACAAAGGGGATGAAGAGAACGGTCGGAGCAGGAGGGATGTAGATAGAGACCAAGACCGTGAACGGGG...
1740 bp · LXL04_015784|LXL04_015784|OH1004|CDS
ATGGACTTCGACGAGTACGAGTACTTGGAGAAGACAGTCGACGAACCTGACACCAGGAATGGTTCATCCTCGAAGACCAAAGACCGCGGCTCGGAGAAGAGCGAAAAGGGTTACAGGCGGAAGGATAGAGAAGACGATGGCGAGGATGCCGAAAATGACCGCATTGAAGAAGAAGGGAGGAGGAGCAAGAAATACAAAGGGGATGAAGAGAACGGTCGGAGCAGGAGGGATGTAGATAGAGACCAAGACCGTGAACGGGG...
Protein
Download Protein FASTA579 aa · LXL04_015784|LXL04_015784|OH1004|PROTEIN
MDFDEYEYLEKTVDEPDTRNGSSSKTKDRGSEKSEKGYRRKDREDDGEDAENDRIEEEGRRSKKYKGDEENGRSRRDVDRDQDRERGREERSSRSERHRSSGRDGDREVERERERDRRRSSRDGDRERSSRGRDKDDDYDKERERKDRDKDREKRDRSKREIERERESSRRSRSHSRLEREREKESLRERERELESRESRRLKDKKEAVEPEADPERDQRTVFAYQMPLKATEWDVYEFFSKAGKVRDVRLIMDRNSRRS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_015784 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_015784 |
|---|---|
| Location | Chr03:84421769-84425746 (-) |
| Description | Similar to Rbm39: RNA-binding protein 39 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000245 spliceosomal complex assembly Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006396 RNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0008380 RNA splicing Biological Process GO:0031397 negative regulation of protein ubiquitination Biological Process GO:0033120 positive regulation of RNA splicing Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process |
| KEGG gene cross-reference | hsa:55147 hsa:9584 mmu:170791 mmu:22185 spo:2542545 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00076.29RRM_1227-288 aaPF00076.29RRM_1325-395 aaPF15519.12RBM39linker415-503 aaPF29326.1RRM_MUD2_C484-573 aaPF00076.29RRM_1509-561 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_015784 | PF00076.29 | RRM_1 | 227 | 288 | 4.1e-41 | 139.4 |
| LXL04_015784 | PF00076.29 | RRM_1 | 325 | 395 | 4.1e-41 | 139.4 |
| LXL04_015784 | PF15519.12 | RBM39linker | 415 | 503 | 1.2e-19 | 71.5 |
| LXL04_015784 | PF29326.1 | RRM_MUD2_C | 484 | 573 | 1.4e-08 | 35.5 |
| LXL04_015784 | PF00076.29 | RRM_1 | 509 | 561 | 4.1e-41 | 139.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.