Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2241 bp · LXL04_015320|LXL04_015320|OH1004|cDNA
ATGGTAAATGCACACGTTAAGGGCAAAATCAACTATTCGCATATCTTCGATAAAATTATAAACTTTCTAAAGTCTAAACCCTCATTTCAAAACGCCTGTTCTGAAATAGACCGAGACAAGAAAAAGGGGGGAAAAGCTATGGAAACGGACGACTGGGGTTTTAGCGCGGAGGAGCTAGATTCCCTCGAAAAGGATGCTCTCAACCGGATCGCTCAACGAAAAGCCActaccaccaccgccaccaccaccaccgccaccac...
2241 bp · LXL04_015320|LXL04_015320|OH1004|CDS
ATGGTAAATGCACACGTTAAGGGCAAAATCAACTATTCGCATATCTTCGATAAAATTATAAACTTTCTAAAGTCTAAACCCTCATTTCAAAACGCCTGTTCTGAAATAGACCGAGACAAGAAAAAGGGGGGAAAAGCTATGGAAACGGACGACTGGGGTTTTAGCGCGGAGGAGCTAGATTCCCTCGAAAAGGATGCTCTCAACCGGATCGCTCAACGAAAAGCCACTACCACCACCGCCACCACCACCACCGCCACCAC...
Protein
Download Protein FASTA746 aa · LXL04_015320|LXL04_015320|OH1004|PROTEIN
MVNAHVKGKINYSHIFDKIINFLKSKPSFQNACSEIDRDKKKGGKAMETDDWGFSAEELDSLEKDALNRIAQRKATTTTATTTTATTSTRAHAPSTFYNNSNTRLLPSTAKPAFESRNAHKVNTMPTASGNPSAARKASGDESSKTRSIKFYLHASGNVAAKFAYDQVLVGALRKIPRATWHAKERLWMFPLVSLPAAEKVLGELSGSNIEVESLDPLLQRAISAASTVPDLQDRYESMPDCIKSKLLPFQQEGVRFILQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_015320 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_015320 |
|---|---|
| Location | Chr03:68464228-68469441 (+) |
| Description | Similar to smarcal1: SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000278 mitotic cell cycle Biological Process GO:0006281 DNA repair Biological Process GO:0006303 double-strand break repair via nonhomologous end joining Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006974 DNA damage response Biological Process GO:0009411 response to UV Biological Process GO:0010172 embryonic body morphogenesis Biological Process GO:0031297 replication fork processing Biological Process GO:0048589 developmental growth Biological Process GO:0071932 replication fork reversal Biological Process GO:0090656 t-circle formation Biological Process GO:0005634 nucleus Cellular Component |
| KEGG gene cross-reference | dre:560412 hsa:50485 mmu:226409 xtr:780385 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00176.30SNF2-rel_dom250-522 aaPF00271.38Helicase_C550-656 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_015320 | PF00176.30 | SNF2-rel_dom | 250 | 522 | 8.8e-34 | 117.6 |
| LXL04_015320 | PF00271.38 | Helicase_C | 550 | 656 | 3.7e-19 | 69.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.