LXL04_015120 | RubberDandelionOmics

Gene overview

LXL04_015120

Reference: OH-1004 Chr: Chr03 Coordinates: 64212751-64216050 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1536 bp · LXL04_015120|LXL04_015120|OH1004|cDNA

ATGTCTCTCACAATTAAGCTCCGAGTCACTCCTACCATTTCACATTTCGACCTCAATCGCAAAACCCAGCAAATTCCAATCAATTTACGAACACCCATTTACCATTCGAACAAATTGTCCACTTCCCTCGTCTTTCGTACCAAAAAGATGGCGGCGTCTCACGTAATCAAGAGTTCTCTAATCGAACCAGATGGCGGGATTCTGATCGATCTCGTAGTTCCAGAAAATCAAAGGAATATGAAAGCTTCGGAGGCGGAGGG...

CDS

Download CDS FASTA

1536 bp · LXL04_015120|LXL04_015120|OH1004|CDS

ATGTCTCTCACAATTAAGCTCCGAGTCACTCCTACCATTTCACATTTCGACCTCAATCGCAAAACCCAGCAAATTCCAATCAATTTACGAACACCCATTTACCATTCGAACAAATTGTCCACTTCCCTCGTCTTTCGTACCAAAAAGATGGCGGCGTCTCACGTAATCAAGAGTTCTCTAATCGAACCAGATGGCGGGATTCTGATCGATCTCGTAGTTCCAGAAAATCAAAGGAATATGAAAGCTTCGGAGGCGGAGGG...

Protein

Download Protein FASTA

511 aa · LXL04_015120|LXL04_015120|OH1004|PROTEIN

MSLTIKLRVTPTISHFDLNRKTQQIPINLRTPIYHSNKLSTSLVFRTKKMAASHVIKSSLIEPDGGILIDLVVPENQRNMKASEAEGMTKVQLTKIDLEWVHVISEGWASPLKGFMREDEYLQSLHFNSLRMKNDDGYGTIVNMSLPIVLAIDDATKEKIGGANDVALVGHDQKIVAILRSIEIYKHNKEERIARTWGTTAPGLPYVEKSITPSGNFLIGGDLEVLSPIKYNDGLDHYRLSPKQLRKEFDRRQADAVFAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015120`
TK1151 ID	TkA02G366260
OH-1004 ID	LXL04_015120
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 97.684 / OH-1004 90.802 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015120

Location Chr03:64212751-64216050 (+)

Description Similar to APS2: ATP sulfurylase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g19920`	ATP sulfurylase 2.	No verified direct reference in this release
`At3g22890`	Mediates selenate (Se) reduction, and promotes Se and sulfur (S) uptake and assimilation.	No verified direct reference in this release
`At4g14680`	ATP-sulfurylase 3, chloroplastic.	No verified direct reference in this release
`At5g43780`	Sulfate adenylyltransferase.	Functional characterization of a gene encoding a fourth ATP sulfurylase isoform from Arabidopsis thaliana.2000 · DOI: 10.1016/s0378-1119(00)00132-3

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015120 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000103 sulfate assimilation Biological Process

GO:0001887 selenium compound metabolic process Biological Process

GO:0009970 cellular response to sulfate starvation Biological Process

GO:0042445 hormone metabolic process Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0050428 3'-phosphoadenosine 5'-phosphosulfate biosynthetic process Biological Process

GO:0070206 protein trimerization Biological Process

GO:0070814 hydrogen sulfide biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G19920

ath:AT3G22890

ath:AT4G14680

ath:AT5G43780

hsa:9060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.848

Rank 1 · LXL04_015120 · OH-1004

Mitochondrion0.138

Rank 2 · LXL04_015120 · OH-1004

Cytoplasm0.088

Rank 3 · LXL04_015120 · OH-1004

Nucleus0.048

Rank 4 · LXL04_015120 · OH-1004

Peroxisome0.038

Rank 5 · LXL04_015120 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14306.13PUA_261-227 aa

PF01747.24ATP-sulfurylase237-459 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015120	`PF14306.13`	PUA_2	61	227	7.5e-43	146.6
LXL04_015120	`PF01747.24`	ATP-sulfurylase	237	459	4.1e-67	226.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q43870`	Arabidopsis thaliana	ATP sulfurylase 2	75.687%	Swiss-Prot	strong database homology
`Q9LIK9`	Arabidopsis thaliana	ATP sulfurylase 1, chloroplastic	76.399%	Swiss-Prot	strong database homology
`O23324`	Arabidopsis thaliana	ATP-sulfurylase 3, chloroplastic	72.748%	Swiss-Prot	strong database homology
`Q9S7D8`	Arabidopsis thaliana	ATP sulfurylase 4, chloroplastic	74.155%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card