LXL04_015066 | RubberDandelionOmics

Gene overview

LXL04_015066

Reference: OH-1004 Chr: Chr03 Coordinates: 62887515-62888324 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

810 bp · LXL04_015066|LXL04_015066|OH1004|cDNA

ATGGAGCTTCTAAAGAACGCGAATTCAGAGCTCGATGATGCGAAAAAACTACTCGAAGAAACCAAAGGAGAAGAGATTTCTCTTAGAGAAGCCATGGAGTCATTGAAACTTGAAGTTGAAGATGTAAAGAAGGAAGTTTTAATTTCAATCGAAGAAGAGTTAAACAGAGAGAAATTACAAACCGATTTAGAACAAATGGAAGTCGAATTCCAACAAGCTGTAACCGAGAAAACCCTAGCAACAACCGAAGCGGAAGAAAT...

CDS

Download CDS FASTA

810 bp · LXL04_015066|LXL04_015066|OH1004|CDS

ATGGAGCTTCTAAAGAACGCGAATTCAGAGCTCGATGATGCGAAAAAACTACTCGAAGAAACCAAAGGAGAAGAGATTTCTCTTAGAGAAGCCATGGAGTCATTGAAACTTGAAGTTGAAGATGTAAAGAAGGAAGTTTTAATTTCAATCGAAGAAGAGTTAAACAGAGAGAAATTACAAACCGATTTAGAACAAATGGAAGTCGAATTCCAACAAGCTGTAACCGAGAAAACCCTAGCAACAACCGAAGCGGAAGAAAT...

Protein

Download Protein FASTA

269 aa · LXL04_015066|LXL04_015066|OH1004|PROTEIN

MELLKNANSELDDAKKLLEETKGEEISLREAMESLKLEVEDVKKEVLISIEEELNREKLQTDLEQMEVEFQQAVTEKTLATTEAEEIELKIREMLLEAEKARAEEDELKRQVEKLWREAQLSETEIHDAETNLEVAEKEVEEAQSAKELANDQMRERSCTKEVTDSDSDNMILLSTMEFEALSKVAEEALIEADTKVEGIMDEVVTIKENERGILEKLEKSMEEQKEIEAGISEAVKSAKVADEARKTIESELRIRVPPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015066`
TK1151 ID	TkA06G216890
OH-1004 ID	LXL04_015066
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015066

Location Chr03:62887515-62888324 (-)

Description Similar to At4g17210: Putative WEB family protein At4g17210

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17210`	Putative WEB family protein At4g17210.	No verified direct reference in this release
`At1g12150`	WEB family protein At1g12150.	No verified direct reference in this release
`At5g55860`	WEB family protein At5g55860.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015066 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009903 chloroplast avoidance movement Biological Process

GO:0009904 chloroplast accumulation movement Biological Process

GO:0071260 cellular response to mechanical stimulus Biological Process

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G12150

ath:AT4G17210

ath:AT5G55860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.692

Rank 1 · LXL04_015066 · OH-1004

Nucleus0.288

Rank 2 · LXL04_015066 · OH-1004

Cell membrane0.117

Rank 3 · LXL04_015066 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_015066 · OH-1004

Plastid0.042

Rank 5 · LXL04_015066 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701.17WEMBL3-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015066	`PF05701.17`	WEMBL	3	254	4.4e-13	49.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23564`	Arabidopsis thaliana	Putative WEB family protein At4g17210	30.315%	Swiss-Prot	moderate database homology
`Q9FWW5`	Arabidopsis thaliana	WEB family protein At1g12150	31.395%	Swiss-Prot	moderate database homology
`Q9LVQ4`	Arabidopsis thaliana	WEB family protein At5g55860	34.630%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card