LXL04_014947 | RubberDandelionOmics

Gene overview

LXL04_014947

Reference: OH-1004 Chr: Chr03 Coordinates: 60196690-60198227 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1122 bp · LXL04_014947|LXL04_014947|OH1004|cDNA

TCCAACTGGTGAGCCTCCAAAACCCTAAATAGCCCACTATATATTCACTTCTTCCGCTTCTAGGGTTTCTCCTAGCTTTTATTTTTCCTCTCAGCCTCTTCTATCAGCCGAGAGAGACGATCGTAACAAAAAATGGCAGACTCACTGGTACTCCGCGGCACAATGAGAGCCCACACCGATTGGGTCACCGCAATCGCCTGCCCGATCGACAACTCCGATATGATTGTCACATCTTCTCGTGACAAGTCAATCATCGTTTG...

CDS

Download CDS FASTA

990 bp · LXL04_014947|LXL04_014947|OH1004|CDS

ATGGCAGACTCACTGGTACTCCGCGGCACAATGAGAGCCCACACCGATTGGGTCACCGCAATCGCCTGCCCGATCGACAACTCCGATATGATTGTCACATCTTCTCGTGACAAGTCAATCATCGTTTGGCGCCTCACCAAGGAAGACAAAACCTACGGTGTTGCGCAGCGCCGTCTCACCGGCCACTCTCACTTTGTTCAAGACGTCGTTCTTTCCTCCGACGGTCAATTCGCTCTATCCGGTTCATGGGACGGCGAACT...

Protein

Download Protein FASTA

329 aa · LXL04_014947|LXL04_014947|OH1004|PROTEIN

MADSLVLRGTMRAHTDWVTAIACPIDNSDMIVTSSRDKSIIVWRLTKEDKTYGVAQRRLTGHSHFVQDVVLSSDGQFALSGSWDGELRLWDLNAGTTARRFVGHTKDVLSVAFSIDNRQIVSASRDKSIKLWNTLGECKYTIQDGDAHNDWVSCVRFSPNTLQPTIVSASWDKTVKIWNLTNCKLRSTLAGHGGYVNTVAVSPDGSLCASGGKDGMILLWDLAEGKRLYSLDASSIIHALCFSPNRYWLCAATESSIKIW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014947`
TK1151 ID	TkA02G381680
OH-1004 ID	LXL04_014947
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014947

Location Chr03:60196690-60198227 (+)

Description Similar to GB1: Guanine nucleotide-binding protein subunit beta-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18080`	Major component of the RACK1 regulatory proteins that play a role in multiple signal transduction pathways.	RACK1 mediates multiple hormone responsiveness and developmental processes in Arabidopsis.2006 · DOI: 10.1093/jxb/erl035 Structure of a signal transduction regulator, RACK1, from Arabidopsis thaliana.2008 · DOI: 10.1110/ps.035121.108 RACK1 genes regulate plant development with unequal genetic redundancy in Arabidopsis.2008 · DOI: 10.1186/1471-2229-8-108

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014947 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009749 response to glucose Biological Process

GO:0009845 seed germination Biological Process

GO:0009967 positive regulation of signal transduction Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010476 gibberellin mediated signaling pathway Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0072344 rescue of stalled cytosolic ribosome Biological Process

GO:2001125 negative regulation of translational frameshifting Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G18080

gmx:547868

nta:107763849

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.557

Rank 1 · LXL04_014947 · OH-1004

Nucleus0.422

Rank 2 · LXL04_014947 · OH-1004

Cell membrane0.092

Rank 3 · LXL04_014947 · OH-1004

Lysosome / Vacuole0.084

Rank 4 · LXL04_014947 · OH-1004

Golgi apparatus0.048

Rank 5 · LXL04_014947 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25047.1Beta-prop_TEP1_2nd3-137 aa

PF25175.2Beta-prop_WDR57-161 aa

PF00400.39WD408-43 aa

PF23381.2Beta-prop_IFT122_1st8-185 aa

PF25173.2Beta-prop_WDR3_1st9-133 aa

PF25174.2Beta-prop_THOC39-250 aa

PF24814.2WD40_Prp199-99 aa

PF24105.2Beta-prop_CAF1B_HIR19-98 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014947	`PF25047.1`	Beta-prop_TEP1_2nd	3	137	1.8e-23	83.7
LXL04_014947	`PF25175.2`	Beta-prop_WDR5	7	161	4.2e-53	181.2
LXL04_014947	`PF00400.39`	WD40	8	43	9.9e-60	197.2
LXL04_014947	`PF23381.2`	Beta-prop_IFT122_1st	8	185	1.3e-54	186.1
LXL04_014947	`PF25173.2`	Beta-prop_WDR3_1st	9	133	1.1e-47	162.9
LXL04_014947	`PF25174.2`	Beta-prop_THOC3	9	250	4.6e-45	154.5
LXL04_014947	`PF24814.2`	WD40_Prp19	9	99	2e-44	152.4
LXL04_014947	`PF24105.2`	Beta-prop_CAF1B_HIR1	9	98	1.1e-24	87.9
LXL04_014947	`PF25172.2`	Beta-prop_WDR3_2nd	10	91	2.4e-35	122.9
LXL04_014947	`PF24807.2`	WD40_CDC20-Fz	10	220	3e-32	112.8
LXL04_014947	`PF23414.2`	Beta-prop_EML_2	10	96	3.7e-25	89.5
LXL04_014947	`PF23409.2`	Beta-prop_EML	10	134	7.4e-13	49.3
LXL04_014947	`PF23609.2`	Beta-prop_EIPR1	14	90	1.5e-12	48.3
LXL04_014947	`PF23869.2`	Beta-prop_WDR75_1st	15	95	5.6e-14	52.9
LXL04_014947	`PF24817.2`	WD40_WDHD1_1st	16	226	7.9e-28	98.2
LXL04_014947	`PF24805.2`	EIF3I	18	97	1.1e-24	88.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O24456`	Arabidopsis thaliana	Small ribosomal subunit protein RACK1z	82.727%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card