LXL04_014928 | RubberDandelionOmics

Gene overview

LXL04_014928

Reference: OH-1004 Chr: Chr03 Coordinates: 59737026-59743070 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

960 bp · LXL04_014928|LXL04_014928|OH1004|cDNA

ATGATTCCAAACAACAAAGAAGAAATGGTAAGAAAATCTAAAATGGAGAAGGTCCGTGCCCGAGAAACCCCACGAGAAGTGGTGGAAGTGAAGAAGTATCATGAAGCTTTCGAGGAACTCCACTTCCGGTCTCCTTTCACGGACGACATTAATGAGTCACTTGTGCCTAAAGGACAGACACAAGGCCAAACAAGAAAAGACGATGAGTTAGCGTGGAATTCAAGCCAAAATGATCCAATCCCACCAAATCACCAAGATAT...

CDS

Download CDS FASTA

960 bp · LXL04_014928|LXL04_014928|OH1004|CDS

ATGATTCCAAACAACAAAGAAGAAATGGTAAGAAAATCTAAAATGGAGAAGGTCCGTGCCCGAGAAACCCCACGAGAAGTGGTGGAAGTGAAGAAGTATCATGAAGCTTTCGAGGAACTCCACTTCCGGTCTCCTTTCACGGACGACATTAATGAGTCACTTGTGCCTAAAGGACAGACACAAGGCCAAACAAGAAAAGACGATGAGTTAGCGTGGAATTCAAGCCAAAATGATCCAATCCCACCAAATCACCAAGATAT...

Protein

Download Protein FASTA

319 aa · LXL04_014928|LXL04_014928|OH1004|PROTEIN

MIPNNKEEMVRKSKMEKVRARETPREVVEVKKYHEAFEELHFRSPFTDDINESLVPKGQTQGQTRKDDELAWNSSQNDPIPPNHQDIAPLIIKGEKETERNKLNTEFDSTRMSSSSAQYNLSFKILLIGDSGVGKSSLLVSFVSNSFEDLSPTIGVDFKIKQLTVGGKRLKLTIWDTAGQERFRTLTSSYYRGAQGIILAYDVSRRDTFTSLSDIWAREVERYSTNQDCVKMLIGNKVDKDSERFVSKEEGITLAKELGC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014928`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014928

Location Chr03:59737026-59743070 (+)

Description Similar to RABC2A: Ras-related protein RABC2a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03530`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At1g43890`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At3g09910`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014928 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0015031 protein transport Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0012505 endomembrane system Cellular Component

KEGG gene cross-reference

ath:AT1G43890

ath:AT3G09910

ath:AT5G03530

dre:445055

vcn:VOLCADRAFT_108490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.519

Rank 1 · LXL04_014928 · OH-1004

Nucleus0.227

Rank 2 · LXL04_014928 · OH-1004

Cell membrane0.182

Rank 3 · LXL04_014928 · OH-1004

Golgi apparatus0.169

Rank 4 · LXL04_014928 · OH-1004

Lysosome / Vacuole0.115

Rank 5 · LXL04_014928 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025.28Arf114-281 aa

PF00071.29Ras124-285 aa

PF08477.20Roc124-239 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014928	`PF00025.28`	Arf	114	281	2.7e-17	63.5
LXL04_014928	`PF00071.29`	Ras	124	285	3.9e-56	189.8
LXL04_014928	`PF08477.20`	Roc	124	239	4.7e-31	108.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49841`	Arabidopsis thaliana	Ras-related protein RABC2a	76.190%	Swiss-Prot	moderate database homology
`O23657`	Arabidopsis thaliana	Ras-related protein RABC1	73.333%	Swiss-Prot	moderate database homology
`Q9SF92`	Arabidopsis thaliana	Ras-related protein RABC2b	70.952%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card