LXL04_014801 | RubberDandelionOmics

Gene overview

LXL04_014801

Reference: OH-1004 Chr: Chr03 Coordinates: 57247386-57252038 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2133 bp · LXL04_014801|LXL04_014801|OH1004|cDNA

ATGGATGTAGTAGTATCGTCTCCTTGCCCTTCTACTCCTCAATGGAACTACGACAGACCTTTCCTCACTGGTCAATTCCACCAGGAAGTAAAATTGACGTCTGGGTCTGTTGAATCAAAGGCAGTGGATATAGGTTTGGAATCTGAGAAGCCTATAGGTTGCTACAATGCTTCCGTGCAGGAACTAATTGTAATAGATGATATTCTATCTGCTTTAGTTGGTATTGAGGGACGATATATTTCTATCAATAGAGTTCGAGG...

CDS

Download CDS FASTA

2133 bp · LXL04_014801|LXL04_014801|OH1004|CDS

ATGGATGTAGTAGTATCGTCTCCTTGCCCTTCTACTCCTCAATGGAACTACGACAGACCTTTCCTCACTGGTCAATTCCACCAGGAAGTAAAATTGACGTCTGGGTCTGTTGAATCAAAGGCAGTGGATATAGGTTTGGAATCTGAGAAGCCTATAGGTTGCTACAATGCTTCCGTGCAGGAACTAATTGTAATAGATGATATTCTATCTGCTTTAGTTGGTATTGAGGGACGATATATTTCTATCAATAGAGTTCGAGG...

Protein

Download Protein FASTA

710 aa · LXL04_014801|LXL04_014801|OH1004|PROTEIN

MDVVVSSPCPSTPQWNYDRPFLTGQFHQEVKLTSGSVESKAVDIGLESEKPIGCYNASVQELIVIDDILSALVGIEGRYISINRVRGNDDSFSFHVDGSMDLALQESSKRIFPLCKSYLVINQFVESRSQFKSGLVNHAFAAALRALLLDYQAMVAQLEHQFRLGRLSIQGLWFYCQPMMGSMQALSTVIKKASASNFVGSAVLNLLQSQAKVMAGNYLVRSLLEKMIESANSAYLGILERWVYEGVIDDPHDEFFIAEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014801`
TK1151 ID	TkA02G395900
OH-1004 ID	LXL04_014801
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014801

Location Chr03:57247386-57252038 (+)

Description Similar to GCP2: Gamma-tubulin complex component 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17410`	Gamma-tubulin complex is necessary for microtubule nucleation at the microtubule organizing centers (MTOCs).	A mutation in the Arabidopsis gamma-tubulin-containing complex causes helical growth and abnormal microtubule branching.2009 · DOI: 10.1242/jcs.044131 Microtubule and katanin-dependent dynamics of microtubule nucleation complexes in the acentrosomal Arabidopsis cortical array.2010 · DOI: 10.1038/ncb2110

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014801 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0007020 microtubule nucleation Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0033566 gamma-tubulin complex localization Biological Process

GO:0048229 gametophyte development Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0090063 positive regulation of microtubule nucleation Biological Process

GO:0000922 spindle pole Cellular Component

GO:0000930 gamma-tubulin complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G17410

ddi:DDB_G0285849

hsa:10844

mmu:74237

pon:100173756

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.647

Rank 1 · LXL04_014801 · OH-1004

Nucleus0.247

Rank 2 · LXL04_014801 · OH-1004

Golgi apparatus0.152

Rank 3 · LXL04_014801 · OH-1004

Cell membrane0.103

Rank 4 · LXL04_014801 · OH-1004

Lysosome / Vacuole0.102

Rank 5 · LXL04_014801 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17681.7GCP_N_terminal65-356 aa

PF04130.19GCP_C_terminal359-702 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014801	`PF17681.7`	GCP_N_terminal	65	356	3.2e-76	257.5
LXL04_014801	`PF04130.19`	GCP_C_terminal	359	702	3.6e-68	231.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5H9`	Arabidopsis thaliana	Gamma-tubulin complex component 2	66.667%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card