RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_014791
Reference: OH-1004 Chr: Chr03 Coordinates: 57033590-57038457 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1557 bp · LXL04_014791|LXL04_014791|OH1004|cDNA

ATGGAAGCATCCGAAGACGCAACACCGATCCTGGACGTGAGGTCGGTGGTTGAAGCCATTTCTACCGACGATGACAATGCCCCTGTGTACCAGGTGGAAAGCCTCTGTATGCGCTGCCATGAAAATGGTACAACAAGATTTTTGTTGACATTGATTCCACATTTTAGAAAGATCTTGTTATCAGCCTTTGAGTGCCCCCATTGTGGCGAGAGGAATAATGAGGTGCAGTTTGCTGGTGAGATACAGCCTCGAGGGTCTCG...

CDS

Download CDS FASTA

1557 bp · LXL04_014791|LXL04_014791|OH1004|CDS

ATGGAAGCATCCGAAGACGCAACACCGATCCTGGACGTGAGGTCGGTGGTTGAAGCCATTTCTACCGACGATGACAATGCCCCTGTGTACCAGGTGGAAAGCCTCTGTATGCGCTGCCATGAAAATGGTACAACAAGATTTTTGTTGACATTGATTCCACATTTTAGAAAGATCTTGTTATCAGCCTTTGAGTGCCCCCATTGTGGCGAGAGGAATAATGAGGTGCAGTTTGCTGGTGAGATACAGCCTCGAGGGTCTCG...

Protein

Download Protein FASTA

518 aa · LXL04_014791|LXL04_014791|OH1004|PROTEIN

MEASEDATPILDVRSVVEAISTDDDNAPVYQVESLCMRCHENGTTRFLLTLIPHFRKILLSAFECPHCGERNNEVQFAGEIQPRGSRYSVEFHSGDQKMLNRQVVKSETATIKIPQLDFEIPPEAQRGSLSTVCSVSTSHVFSTYKNKEGIYVFFSLLTCLAYYLLQVEGILLRASEELQALQEERKKVDPQTAEAIDKFISKLKECATGNFPFTFILDDPAGNSFVENPFAPSSDPSLRIELYDRSHEQQEMLGYSFDP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_014791
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_014791
LocationChr03:57033590-57038457 (-)
DescriptionSimilar to Zpr1: Zinc finger protein ZPR1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014791 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000226 microtubule cytoskeleton organization Biological Process
GO:0006260 DNA replication Biological Process
GO:0006397 mRNA processing Biological Process
GO:0006457 protein folding Biological Process
GO:0007165 signal transduction Biological Process
GO:0008380 RNA splicing Biological Process
GO:0010628 positive regulation of gene expression Biological Process
GO:0030576 Cajal body organization Biological Process
GO:0033120 positive regulation of RNA splicing Biological Process
GO:0042023 DNA endoreduplication Biological Process
GO:0042307 positive regulation of protein import into nucleus Biological Process
GO:0045787 positive regulation of cell cycle Biological Process
KEGG gene cross-reference
bta:504523
hsa:8882
mmu:22687
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.758
Rank 1 · LXL04_014791 · OH-1004
Nucleus0.450
Rank 2 · LXL04_014791 · OH-1004
Mitochondrion0.074
Rank 3 · LXL04_014791 · OH-1004
Peroxisome0.051
Rank 4 · LXL04_014791 · OH-1004
Endoplasmic reticulum0.043
Rank 5 · LXL04_014791 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03367.20Zn_ribbon_ZPR131-83 aa
PF22794.2jr-ZPR199-133 aa
PF22794.2jr-ZPR1167-256 aa
PF03367.20Zn_ribbon_ZPR1305-360 aa
PF22794.2jr-ZPR1374-499 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_014791PF03367.20Zn_ribbon_ZPR131834.6e-50167.6
LXL04_014791PF22794.2jr-ZPR1991337.2e-81269.0
LXL04_014791PF22794.2jr-ZPR11672567.2e-81269.0
LXL04_014791PF03367.20Zn_ribbon_ZPR13053604.6e-50167.6
LXL04_014791PF22794.2jr-ZPR13744997.2e-81269.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser