LXL04_014777 | RubberDandelionOmics

Gene overview

LXL04_014777

Reference: OH-1004 Chr: Chr03 Coordinates: 56845642-56850124 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3135 bp · LXL04_014777|LXL04_014777|OH1004|cDNA

ATGACGAAGAAACCGCGAGTACCGGCGGTGCTATGGAAATTGTTCCAAAACCGTGCCCGCACACTCGCAGAAACCATGCTATCCTTAATACCTCCACCGTCGTCGGCGACGGTTCAATGCCGTTGCAAGGGTCGTCGACATTGCCTCCGATGTTGTTCCGTTGATGACCGTATGTCGTATCTGATCAGAGAAGACGACCCACCCGACTACTCTAAGCTCCTCAATCAATGTTTTGTGGTCGTCTCGGACAATGCGCCCTC...

CDS

Download CDS FASTA

3135 bp · LXL04_014777|LXL04_014777|OH1004|CDS

ATGACGAAGAAACCGCGAGTACCGGCGGTGCTATGGAAATTGTTCCAAAACCGTGCCCGCACACTCGCAGAAACCATGCTATCCTTAATACCTCCACCGTCGTCGGCGACGGTTCAATGCCGTTGCAAGGGTCGTCGACATTGCCTCCGATGTTGTTCCGTTGATGACCGTATGTCGTATCTGATCAGAGAAGACGACCCACCCGACTACTCTAAGCTCCTCAATCAATGTTTTGTGGTCGTCTCGGACAATGCGCCCTC...

Protein

Download Protein FASTA

1044 aa · LXL04_014777|LXL04_014777|OH1004|PROTEIN

MTKKPRVPAVLWKLFQNRARTLAETMLSLIPPPSSATVQCRCKGRRHCLRCCSVDDRMSYLIREDDPPDYSKLLNQCFVVVSDNAPSPPLFDPRSRWSQLEIVRMTIDMMSCEETSTKNMICTGYNKVGDGLMVYLLKYCSIFIPLHRKKHQQVAEKHHALDPVSMTVDIPETSSTCLGCNVKGSVTHIKHISKMSCHQDSTTDADCTGTTTTQENGVVGGAHSRKRVRSYAWQRRHKRRKLLSHNMCECDTNSSLPEDK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014777`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014777

Location Chr03:56845642-56850124 (+)

Description Similar to TERT: Telomerase reverse transcriptase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16850`	Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most eukaryotes.	Molecular cloning and characterization of AtTERT, a telomerase reverse transcriptase homolog in Arabidopsis thaliana.1999 · DOI: 10.1016/s0014-5793(99)01083-2 Disruption of the telomerase catalytic subunit gene from Arabidopsis inactivates telomerase and leads to a slow loss of telomeric DNA.1999 · DOI: 10.1073/pnas.96.26.14813 Rearrangements of ribosomal DNA clusters in late generation telomerase-deficient Arabidopsis.2003 · DOI: 10.1007/s00412-003-0251-7

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0293100`	Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most eukaryotes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014777 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0007004 telomere maintenance via telomerase Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010449 root meristem growth Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0050000 chromosome localization Biological Process

GO:0000333 telomerase catalytic core complex Cellular Component

GO:0000781 chromosome, telomeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005697 telomerase holoenzyme complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT5G16850

bta:518884

cfa:403412

dosa:Os12g0293100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.871

Rank 1 · LXL04_014777 · OH-1004

Cytoplasm0.153

Rank 2 · LXL04_014777 · OH-1004

Mitochondrion0.035

Rank 3 · LXL04_014777 · OH-1004

Cell membrane0.026

Rank 4 · LXL04_014777 · OH-1004

Endoplasmic reticulum0.014

Rank 5 · LXL04_014777 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12009.14Telomerase_RBD388-516 aa

PF00078.33RVT_1568-821 aa

PF21399.3TERT_C885-1011 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014777	`PF12009.14`	Telomerase_RBD	388	516	2.5e-37	128.7
LXL04_014777	`PF00078.33`	RVT_1	568	821	4.2e-11	43.8
LXL04_014777	`PF21399.3`	TERT_C	885	1011	3e-18	67.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SPU7`	Arabidopsis thaliana	Telomerase reverse transcriptase	35.324%	Swiss-Prot	moderate database homology
`Q8LKW0`	Oryza sativa subsp. japonica	Telomerase reverse transcriptase	36.768%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card