LXL04_014763 | RubberDandelionOmics

Gene overview

LXL04_014763

Reference: OH-1004 Chr: Chr03 Coordinates: 56516865-56521530 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1498 bp · LXL04_014763|LXL04_014763|OH1004|cDNA

ATGACGAAGGTGGGTCGCGATTTTAGCTATACAATGCAAAGCTTGTCAGTTCCAGCTGTATCTGCCGATGTGATGTTTGCATCTACTCGGTTTCCAAACTACAAAATTGGAGCTAATGATCAAATTATGTACGGAAGTGAAGACCAAAAGCTGGTTTCAATGAAGGACGTCATAGCCAAAGAGACCGCTCAGTTGTTAGAACAACAAAAACGCCTATCTGTTCGTGATTTGGCTAGTAAATTTGAGAAAGGTTTAGCGGC...

CDS

Download CDS FASTA

1485 bp · LXL04_014763|LXL04_014763|OH1004|CDS

ATGACGAAGGTGGGTCGCGATTTTAGCTATACAATGCAAAGCTTGTCAGTTCCAGCTGTATCTGCCGATGTGATGTTTGCATCTACTCGGTTTCCAAACTACAAAATTGGAGCTAATGATCAAATTATGTACGGAAGTGAAGACCAAAAGCTGGTTTCAATGAAGGACGTCATAGCCAAAGAGACCGCTCAGTTGTTAGAACAACAAAAACGCCTATCTGTTCGTGATTTGGCTAGTAAATTTGAGAAAGGTTTAGCGGC...

Protein

Download Protein FASTA

494 aa · LXL04_014763|LXL04_014763|OH1004|PROTEIN

MTKVGRDFSYTMQSLSVPAVSADVMFASTRFPNYKIGANDQIMYGSEDQKLVSMKDVIAKETAQLLEQQKRLSVRDLASKFEKGLAAAAKLSDEAKHRDVSCLEKHVLLKKLRDALESLRGRVVGKNMDDVEEAIAMVEALAVQLTQREGELIQEKAEVKKLANFLKQASEDAKKLVDEERSLARTEIENARAAVQRVEEALQEQERMSKSSGTQDLEELMKEVQEARRIKMLHQPSKVMDMEHELQALRVQLAEKSKRS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014763`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014763

Location Chr03:56516865-56521530 (+)

Description Similar to SCAB1: Stomatal closure-related actin-binding protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26770`	Plant-specific actin binding protein that bundles and stabilizes microfilaments (MFs).	The plant-specific actin binding protein SCAB1 stabilizes actin filaments and regulates stomatal movement in Arabidopsis.2011 · DOI: 10.1105/tpc.111.086546
`At3g56480`	Probable plant-specific actin binding protein that bundles and stabilizes microfilaments (MFs).	No verified direct reference in this release
`At2g40820`	Probable plant-specific actin binding protein that bundles and stabilizes microfilaments (MFs).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014763 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007015 actin filament organization Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0003779 actin binding Molecular Function

KEGG gene cross-reference

ath:AT2G26770

ath:AT2G40820

ath:AT3G56480

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.563

Rank 1 · LXL04_014763 · OH-1004

Nucleus0.262

Rank 2 · LXL04_014763 · OH-1004

Cell membrane0.207

Rank 3 · LXL04_014763 · OH-1004

Golgi apparatus0.122

Rank 4 · LXL04_014763 · OH-1004

Endoplasmic reticulum0.068

Rank 5 · LXL04_014763 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16711.11SCAB-ABD54-96 aa

PF16712.11SCAB_CC101-267 aa

PF16709.12SCAB-Ig281-378 aa

PF17684.8SCAB-PH381-488 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014763	`PF16711.11`	SCAB-ABD	54	96	9.2e-25	87.0
LXL04_014763	`PF16712.11`	SCAB_CC	101	267	8.4e-80	267.2
LXL04_014763	`PF16709.12`	SCAB-Ig	281	378	1.7e-34	118.5
LXL04_014763	`PF17684.8`	SCAB-PH	381	488	3.8e-57	191.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48791`	Arabidopsis thaliana	Stomatal closure-related actin-binding protein 1	72.041%	Swiss-Prot	strong database homology
`Q8GX05`	Arabidopsis thaliana	Stomatal closure-related actin-binding protein 3	57.602%	Swiss-Prot	strong database homology
`F4IIZ9`	Arabidopsis thaliana	Stomatal closure-related actin-binding protein 2	56.723%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card