LXL04_014554 | RubberDandelionOmics

Gene overview

LXL04_014554

Reference: OH-1004 Chr: Chr03 Coordinates: 52407379-52409766 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1251 bp · LXL04_014554|LXL04_014554|OH1004|cDNA

ATGGAGAAAAATGATAATAACTACTCGGGAGGTTTGCTTGGAGTGGACTTCAATGGTGATCATGACCATGAGTATTATCAACACCACAATCAACAACAGCTACAACAGCAGTTTATGGTGAAAAACGCATACGAAAACGGGAACCAAATGGTGGATTACATGCTCAATAATCCGATACAACATCTACCTTCTGGTGGGTTTTGTAGCTCAAACTCGTTGGATAAGTTAAGTTTTGCAGATGTAATGCAGTTTGCAGATCT...

CDS

Download CDS FASTA

1251 bp · LXL04_014554|LXL04_014554|OH1004|CDS

ATGGAGAAAAATGATAATAACTACTCGGGAGGTTTGCTTGGAGTGGACTTCAATGGTGATCATGACCATGAGTATTATCAACACCACAATCAACAACAGCTACAACAGCAGTTTATGGTGAAAAACGCATACGAAAACGGGAACCAAATGGTGGATTACATGCTCAATAATCCGATACAACATCTACCTTCTGGTGGGTTTTGTAGCTCAAACTCGTTGGATAAGTTAAGTTTTGCAGATGTAATGCAGTTTGCAGATCT...

Protein

Download Protein FASTA

416 aa · LXL04_014554|LXL04_014554|OH1004|PROTEIN

MEKNDNNYSGGLLGVDFNGDHDHEYYQHHNQQQLQQQFMVKNAYENGNQMVDYMLNNPIQHLPSGGFCSSNSLDKLSFADVMQFADLGPKLALNQNKTKHGHDDDQENGIDPVYFLKFPVLNERVQEDHHHQSLLAPLEDDENEHRVMIEGGDQRDDDARVSDTSVRLQFIGDDAHKTLVGDGKNKRKRPRTIKTSEEVESQRMTHIAVERNRRKQMNEHLRVLRSLMPGSYVQRGDQASIIGGAIEFVRELEQLLQCLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014554`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014554

Location Chr03:52407379-52409766 (+)

Description Similar to FAMA: Transcription factor FAMA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24140`	Transcription activator.	Arabidopsis FAMA controls the final proliferation/differentiation switch during stomatal development.2006 · DOI: 10.1105/tpc.106.046136 Termination of asymmetric cell division and differentiation of stomata.2007 · DOI: 10.1038/nature05467 Deep functional redundancy between FAMA and FOUR LIPS in stomatal development.2014 · DOI: 10.1111/tpj.12489 Arabidopsis guard cell integrity involves the epigenetic stabilization of the FLP and FAMA transcription factor genes.2014 · DOI: 10.1111/tpj.12516
`At1g22490`	Transcription factor bHLH94.	No verified direct reference in this release
`At3g06120`	Transcription factor.	Termination of asymmetric cell division and differentiation of stomata.2007 · DOI: 10.1038/nature05467
`At1g72210`	Transcription factor bHLH96.	No verified direct reference in this release
`At4g01460`	Transcription factor bHLH57.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014554 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0010052 guard cell differentiation Biological Process

GO:0010374 stomatal complex development Biological Process

GO:0010377 guard cell fate commitment Biological Process

GO:0010444 guard mother cell differentiation Biological Process

GO:0045597 positive regulation of cell differentiation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0051782 negative regulation of cell division Biological Process

GO:0090547 response to low humidity Biological Process

GO:0090627 plant epidermal cell differentiation Biological Process

KEGG gene cross-reference

ath:AT1G22490

ath:AT1G72210

ath:AT3G06120

ath:AT3G24140

ath:AT4G01460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.967

Rank 1 · LXL04_014554 · OH-1004

Cytoplasm0.088

Rank 2 · LXL04_014554 · OH-1004

Cell membrane0.032

Rank 3 · LXL04_014554 · OH-1004

Endoplasmic reticulum0.024

Rank 4 · LXL04_014554 · OH-1004

Plastid0.013

Rank 5 · LXL04_014554 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH202-253 aa

PF22754.5bHLH-TF_ACT-like_plant319-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014554	`PF00010.32`	HLH	202	253	8.1e-12	45.5
LXL04_014554	`PF22754.5`	bHLH-TF_ACT-like_plant	319	396	1.6e-08	35.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56YJ8`	Arabidopsis thaliana	Transcription factor FAMA	56.863%	Swiss-Prot	strong database homology
`Q9SK91`	Arabidopsis thaliana	Transcription factor bHLH94	44.335%	Swiss-Prot	weak database homology
`Q9M8K6`	Arabidopsis thaliana	Transcription factor MUTE	44.615%	Swiss-Prot	weak database homology
`Q9C7T4`	Arabidopsis thaliana	Transcription factor bHLH96	42.439%	Swiss-Prot	weak database homology
`Q9M128`	Arabidopsis thaliana	Transcription factor bHLH57	42.723%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card