LXL04_014552 | RubberDandelionOmics

Gene overview

LXL04_014552

Reference: OH-1004 Chr: Chr03 Coordinates: 52372125-52374970 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1653 bp · LXL04_014552|LXL04_014552|OH1004|cDNA

ATGATCATAGTTTACGAGTATATCTCCGGTGGGAACCTCGGTGACCGCCTGCATAAAATTAACGGACAGATAAAAATTTCGCCGCTGTCTTGGGTGGAGCGCCTGAAAATATGCATTGGGACCGCACGTGCGTTAGATTACCTTCACACAGGAACAAATTCCCACCACCGTGTCATTCATAGGGATGTTAAAAGCTCAAATATACTCTTGGATGATTATATGGCGGCTAAGGTATCGGATCTTGGGGTGTCGAAAATTGG...

CDS

Download CDS FASTA

1653 bp · LXL04_014552|LXL04_014552|OH1004|CDS

ATGATCATAGTTTACGAGTATATCTCCGGTGGGAACCTCGGTGACCGCCTGCATAAAATTAACGGACAGATAAAAATTTCGCCGCTGTCTTGGGTGGAGCGCCTGAAAATATGCATTGGGACCGCACGTGCGTTAGATTACCTTCACACAGGAACAAATTCCCACCACCGTGTCATTCATAGGGATGTTAAAAGCTCAAATATACTCTTGGATGATTATATGGCGGCTAAGGTATCGGATCTTGGGGTGTCGAAAATTGG...

Protein

Download Protein FASTA

550 aa · LXL04_014552|LXL04_014552|OH1004|PROTEIN

MIIVYEYISGGNLGDRLHKINGQIKISPLSWVERLKICIGTARALDYLHTGTNSHHRVIHRDVKSSNILLDDYMAAKVSDLGVSKIGHVDQPFTHVSTDVKGSFGYFDPNYFMTRRLTRKSDVYSFGVVLLEVLCGQPAVDPSLDDDELGLSLVGQISPDCLQGFVGITDKCLKTRPKDRPTMTEVVVVLEGVLVAQEKANCFVNECCSRYDDQGRNSYVKSGKITFSRMLRNIFVTPVRDDVERMEKKKRQYKSVLPCT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014552`
TK1151 ID	TkA02G413460
OH-1004 ID	LXL04_014552
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	90.900
Protein coverage (%)	TK1151 100.000 / OH-1004 44.182 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014552

Location Chr03:52372125-52374970 (-)

Description Similar to PIX13: Probable serine/threonine-protein kinase PIX13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g17220`	May be involved in plant defense signaling.	No verified direct reference in this release
`At2g02800`	May be involved in plant defense signaling.	No verified direct reference in this release
`At2g28930`	Possible bi-functional kinase.	Light-induced stomatal opening is affected by the guard cell protein kinase APK1b.2014 · DOI: 10.1371/journal.pone.0097161
`At4g35600`	Acts as a spatial inhibitor of signaling that modulates abscission zone cell adhesion and expansion.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0110900`	Functions downstream of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.	OsCERK1 and OsRLCK176 play important roles in peptidoglycan and chitin signaling in rice innate immunity.2014 · DOI: 10.1111/tpj.12710

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014552 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G02800

ath:AT2G17220

dosa:Os05g0110900

osa:4337593

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.613

Rank 1 · LXL04_014552 · OH-1004

Cytoplasm0.287

Rank 2 · LXL04_014552 · OH-1004

Nucleus0.219

Rank 3 · LXL04_014552 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_014552 · OH-1004

Golgi apparatus0.035

Rank 5 · LXL04_014552 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr1-188 aa

PF00069.32Pkinase1-187 aa

PF00069.32Pkinase309-407 aa

PF07714.24PK_Tyr_Ser-Thr311-402 aa

PF07714.24PK_Tyr_Ser-Thr405-544 aa

PF00069.32Pkinase407-542 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014552	`PF07714.24`	PK_Tyr_Ser-Thr	1	188	1.6e-57	195.5
LXL04_014552	`PF00069.32`	Pkinase	1	187	8.7e-56	189.9
LXL04_014552	`PF00069.32`	Pkinase	309	407	8.7e-56	189.9
LXL04_014552	`PF07714.24`	PK_Tyr_Ser-Thr	311	402	1.6e-57	195.5
LXL04_014552	`PF07714.24`	PK_Tyr_Ser-Thr	405	544	1.6e-57	195.5
LXL04_014552	`PF00069.32`	Pkinase	407	542	8.7e-56	189.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SII6`	Arabidopsis thaliana	Probable serine/threonine-protein kinase PIX13	50.166%	Swiss-Prot	weak database homology
`O49840`	Arabidopsis thaliana	Probable serine/threonine-protein kinase PBL3	49.020%	Swiss-Prot	weak database homology
`P46573`	Arabidopsis thaliana	Probable serine/threonine-protein kinase PBL10	48.052%	Swiss-Prot	weak database homology
`P27450`	Arabidopsis thaliana	Probable serine/threonine-protein kinase CST	45.183%	Swiss-Prot	weak database homology
`Q65XV8`	Oryza sativa subsp. japonica	Receptor-like cytoplasmic kinase 176	48.185%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card