LXL04_014507 | RubberDandelionOmics

Gene overview

LXL04_014507

Reference: OH-1004 Chr: Chr03 Coordinates: 51249279-51253664 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2574 bp · LXL04_014507|LXL04_014507|OH1004|cDNA

ATGGCGACCAAAGTACTCATGGTCGCGGAGAAGCCAAGTATCGCACTTTCGATTGCTACAGCACTCTCCGGTGGTCGAATGTCATCACGAAGGGGTAGTACTGAGGTTCATGAGTTTGATGGGACGTTTTTAGGACATCGGGTACAATATAAAGTGACATCAGTGATTGGTCATGTTTTCAGTGTAGATTTTCCACCAACTTATCAAAATTGGTCAGCCACAGATCCTCTCACTCTTTTTGAAGCTCCAGTTCTCAAATC...

CDS

Download CDS FASTA

2574 bp · LXL04_014507|LXL04_014507|OH1004|CDS

ATGGCGACCAAAGTACTCATGGTCGCGGAGAAGCCAAGTATCGCACTTTCGATTGCTACAGCACTCTCCGGTGGTCGAATGTCATCACGAAGGGGTAGTACTGAGGTTCATGAGTTTGATGGGACGTTTTTAGGACATCGGGTACAATATAAAGTGACATCAGTGATTGGTCATGTTTTCAGTGTAGATTTTCCACCAACTTATCAAAATTGGTCAGCCACAGATCCTCTCACTCTTTTTGAAGCTCCAGTTCTCAAATC...

Protein

Download Protein FASTA

857 aa · LXL04_014507|LXL04_014507|OH1004|PROTEIN

MATKVLMVAEKPSIALSIATALSGGRMSSRRGSTEVHEFDGTFLGHRVQYKVTSVIGHVFSVDFPPTYQNWSATDPLTLFEAPVLKSESNPKAHIRQHINREARGCGDLVLWLDCDREGENICFEVIECAGFHPNDGRRIHRARFSSVTEKDITHAMKNLVQPNKDEALAVDARQEIDLKVGVAFTRFQTTYFQGKYGNLDSRVISYGPCQTPTLGFCVQRYLQINTFKPEKFWVVYPYIIKSGFELKLEWDRNRLFDHD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014507`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014507

Location Chr03:51249279-51253664 (-)

Description Similar to At2g32000: DNA topoisomerase 3-beta

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32000`	Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0500600`	Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014507 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006265 DNA topological change Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0141194 siRNA-mediated heterochromatin formation Biological Process

GO:0000793 condensed chromosome Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0140225 DNA topoisomerase III-beta-TDRD3 complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G32000

dme:Dmel_CG3458

dosa:Os09g0500600

hsa:8940

mmu:21976

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.587

Rank 1 · LXL04_014507 · OH-1004

Cytoplasm0.469

Rank 2 · LXL04_014507 · OH-1004

Mitochondrion0.105

Rank 3 · LXL04_014507 · OH-1004

Cell membrane0.029

Rank 4 · LXL04_014507 · OH-1004

Peroxisome0.025

Rank 5 · LXL04_014507 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01751.29Toprim5-145 aa

PF01131.26Topoisom_bac163-573 aa

PF23546.2Zn_ribbon_TOP3B607-646 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014507	`PF01751.29`	Toprim	5	145	2.5e-13	50.7
LXL04_014507	`PF01131.26`	Topoisom_bac	163	573	1.7e-104	350.8
LXL04_014507	`PF23546.2`	Zn_ribbon_TOP3B	607	646	1.3e-19	70.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4ISQ7`	Arabidopsis thaliana	DNA topoisomerase 3-beta	73.666%	Swiss-Prot	strong database homology
`Q0J0S6`	Oryza sativa subsp. japonica	DNA topoisomerase 3-beta	72.402%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card