LXL04_014383 | RubberDandelionOmics

Gene overview

LXL04_014383

Reference: OH-1004 Chr: Chr03 Coordinates: 47969764-47974383 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1212 bp · LXL04_014383|LXL04_014383|OH1004|cDNA

ATGGACGCAAAAAAACCATTGTTGTCAAGTGAGGGAGATTCAAAACACATACGAAGGAACAGACGTAATTCAGTCACTAGCCTGAGATGCGATTTCTTTTCTAAATTGCCTGAAAAAGTCCGACGTGGCCTTGACCCTGAAGCTCCATTCCAGGTCGATCTTTCAAAAGCCATCGGACTAATAGAAGGGGAGAAAGAATACTATGAAAAACAGTTTGCAGCTTTGAAATCGTTTGAAGAAGTCGATTCATTACCTACAAC...

CDS

Download CDS FASTA

1212 bp · LXL04_014383|LXL04_014383|OH1004|CDS

ATGGACGCAAAAAAACCATTGTTGTCAAGTGAGGGAGATTCAAAACACATACGAAGGAACAGACGTAATTCAGTCACTAGCCTGAGATGCGATTTCTTTTCTAAATTGCCTGAAAAAGTCCGACGTGGCCTTGACCCTGAAGCTCCATTCCAGGTCGATCTTTCAAAAGCCATCGGACTAATAGAAGGGGAGAAAGAATACTATGAAAAACAGTTTGCAGCTTTGAAATCGTTTGAAGAAGTCGATTCATTACCTACAAC...

Protein

Download Protein FASTA

403 aa · LXL04_014383|LXL04_014383|OH1004|PROTEIN

MDAKKPLLSSEGDSKHIRRNRRNSVTSLRCDFFSKLPEKVRRGLDPEAPFQVDLSKAIGLIEGEKEYYEKQFAALKSFEEVDSLPTTATDVNNNEEEDLIEQAQHERAINTSNWANIFLLALKIYATVQSGSLAIAASTLDSLLDLMAGAILWFTHLSMKSINIYKYPIGKLRVQPVGIIIFAAIMATLGFQVLIQAVEHLIRNSPSEKMNNLQLIWLYTIMLTATFVKLILYIYCRSSGNKIVRAYAKDHYFDVVTNLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014383`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014383

Location Chr03:47969764-47974383 (+)

Description Similar to MTP4: Metal tolerance protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58060`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`At1g79520`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0226400`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`Os02g0775100`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release
`Os01g0837800`	Involved in sequestration of excess metal in the cytoplasm into vacuoles to maintain metal homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014383 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006826 iron ion transport Biological Process

GO:0009845 seed germination Biological Process

GO:0048316 seed development Biological Process

GO:0071421 manganese ion transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0035618 root hair Cellular Component

GO:0005384 manganese ion transmembrane transporter activity Molecular Function

GO:0008324 monoatomic cation transmembrane transporter activity Molecular Function

GO:0010486 manganese:proton antiporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G79520

ath:AT3G58060

dosa:Os01g0837800

dosa:Os02g0775100

dosa:Os03g0226400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.315

Rank 1 · LXL04_014383 · OH-1004

Endoplasmic reticulum0.271

Rank 2 · LXL04_014383 · OH-1004

Cytoplasm0.263

Rank 3 · LXL04_014383 · OH-1004

Lysosome / Vacuole0.248

Rank 4 · LXL04_014383 · OH-1004

Cell membrane0.128

Rank 5 · LXL04_014383 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01545.27Cation_efflux114-303 aa

PF16916.12ZT_dimer319-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014383	`PF01545.27`	Cation_efflux	114	303	4.2e-26	92.7
LXL04_014383	`PF16916.12`	ZT_dimer	319	383	3.1e-07	31.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2P2`	Arabidopsis thaliana	Putative metal tolerance protein C3	70.968%	Swiss-Prot	strong database homology
`Q9SAJ7`	Arabidopsis thaliana	Metal tolerance protein 9	56.024%	Swiss-Prot	strong database homology
`Q10PP8`	Oryza sativa subsp. japonica	Metal tolerance protein 4	72.637%	Swiss-Prot	strong database homology
`Q6Z7K5`	Oryza sativa subsp. japonica	Metal tolerance protein 3	68.550%	Swiss-Prot	strong database homology
`Q5NA18`	Oryza sativa subsp. japonica	Metal tolerance protein 5	55.015%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card