LXL04_014373 | RubberDandelionOmics

Gene overview

LXL04_014373

Reference: OH-1004 Chr: Chr03 Coordinates: 47737743-47739509 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · LXL04_014373|LXL04_014373|OH1004|cDNA

ATGAACGCTTTAGCGGCAACAAACCGTAACTTTAAGCTGGCAGCTCGCCTGTTGGGGTTAGACTCCAAACTCGAAAAGAGTCTTCTCATTCCGTTCAGAGAAATCAAGGTTGAGTGTACAATTCCAAAAGATGATGGTAGCTTGGTATCTTACGTCGGGTTCAGGATTCAACATGACAATGCTCGAGGACCGATGAAAGGGGGAATCAGATACCATCCGGAGGTCGATCCCGATGAGGTGAACGCTTTAGCGCAACTGAT...

CDS

Download CDS FASTA

1236 bp · LXL04_014373|LXL04_014373|OH1004|CDS

ATGAACGCTTTAGCGGCAACAAACCGTAACTTTAAGCTGGCAGCTCGCCTGTTGGGGTTAGACTCCAAACTCGAAAAGAGTCTTCTCATTCCGTTCAGAGAAATCAAGGTTGAGTGTACAATTCCAAAAGATGATGGTAGCTTGGTATCTTACGTCGGGTTCAGGATTCAACATGACAATGCTCGAGGACCGATGAAAGGGGGAATCAGATACCATCCGGAGGTCGATCCCGATGAGGTGAACGCTTTAGCGCAACTGAT...

Protein

Download Protein FASTA

411 aa · LXL04_014373|LXL04_014373|OH1004|PROTEIN

MNALAATNRNFKLAARLLGLDSKLEKSLLIPFREIKVECTIPKDDGSLVSYVGFRIQHDNARGPMKGGIRYHPEVDPDEVNALAQLMTWKTAVANIPYGGAKGGIGCNPGELSISELERLTRVFTQKIHDLIGIHTDVPAPDMGTGPQTMAWILDEYSKFHGYSPAVVTGKPIDLGGSLGRDAATGRGVLFATEALLNDHGKTVSGQRFVIQGFGNVGSWAAQLIHEAGGKVVAVSDISGAIHDKNGIDIPSLMKHVKEH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014373`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014373

Location Chr03:47737743-47739509 (+)

Description Similar to GDH1: Glutamate dehydrogenase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18170`	Glutamate dehydrogenase 1.	No verified direct reference in this release
`At3g03910`	Probable glutamate dehydrogenase 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0794500`	Glutamate dehydrogenase 1, mitochondrial.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014373 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006538 L-glutamate catabolic process Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0009646 response to absence of light Biological Process

GO:0019740 nitrogen utilization Biological Process

GO:1901698 response to nitrogen compound Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004352 glutamate dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT3G03910

ath:AT5G18170

dosa:Os03g0794500

sly:544015

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.490

Rank 1 · LXL04_014373 · OH-1004

Mitochondrion0.302

Rank 2 · LXL04_014373 · OH-1004

Nucleus0.154

Rank 3 · LXL04_014373 · OH-1004

Plastid0.109

Rank 4 · LXL04_014373 · OH-1004

Peroxisome0.089

Rank 5 · LXL04_014373 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02812.24ELFV_dehydrog_N33-159 aa

PF00208.28ELFV_dehydrog176-408 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014373	`PF02812.24`	ELFV_dehydrog_N	33	159	1.2e-49	168.0
LXL04_014373	`PF00208.28`	ELFV_dehydrog	176	408	7e-83	278.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q43314`	Arabidopsis thaliana	Glutamate dehydrogenase 1	89.781%	Swiss-Prot	strong database homology
`Q9S7A0`	Arabidopsis thaliana	Probable glutamate dehydrogenase 3	86.553%	Swiss-Prot	strong database homology
`Q852M0`	Oryza sativa subsp. japonica	Glutamate dehydrogenase 1, mitochondrial	86.375%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card