Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1926 bp · LXL04_014257|LXL04_014257|OH1004|cDNA
atggagaatatgaaaTATGCCGAGGAGCTTGTGAGGGAATTTCTGTTCTTCAGAGGATTCACAACCACTTTGCAATCTTTCGAGAAAGAATTGGCCACAGATATTGGCAAAGGATTTCACAAGGATAAAATCTTTGACCTAATTTTTTCAGTATACATCCCTAAATTCCAGGCACAAAATCTAATTTCCTTGCTGACTTTTTTCAAACAATGTTTTTCGTCATCCGAAACCGTCTTGCTTGCTACCTTGTCCAAATTGGA...
1926 bp · LXL04_014257|LXL04_014257|OH1004|CDS
ATGGAGAATATGAAATATGCCGAGGAGCTTGTGAGGGAATTTCTGTTCTTCAGAGGATTCACAACCACTTTGCAATCTTTCGAGAAAGAATTGGCCACAGATATTGGCAAAGGATTTCACAAGGATAAAATCTTTGACCTAATTTTTTCAGTATACATCCCTAAATTCCAGGCACAAAATCTAATTTCCTTGCTGACTTTTTTCAAACAATGTTTTTCGTCATCCGAAACCGTCTTGCTTGCTACCTTGTCCAAATTGGA...
Protein
Download Protein FASTA641 aa · LXL04_014257|LXL04_014257|OH1004|PROTEIN
MENMKYAEELVREFLFFRGFTTTLQSFEKELATDIGKGFHKDKIFDLIFSVYIPKFQAQNLISLLTFFKQCFSSSETVLLATLSKLEISVLRYYIVHAVQSGRNDKIIEFFGVHGDDLLQRDHDWMSWFGVSSLLSFSAPTLIVSSGFDIFPAAIPYIKNPSLDPLFRVYFSRENQCKFSLINPRIPALLKISSEKHNVNNLKNDIKHLNTRLSQLQALLEEKEAQLRRSRSNVSTARQLSIGGNNESLCSTSETFSKES...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_014257 |
|---|---|
| TK1151 ID | TkA02G444630 |
| OH-1004 ID | LXL04_014257 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 93.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_014257 |
|---|---|
| Location | Chr03:44642342-44645199 (-) |
| Description | Similar to wdr91: WD repeat-containing protein 91 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0042176 regulation of protein catabolic process Biological Process GO:0045022 early endosome to late endosome transport Biological Process GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process GO:0005829 cytosol Cellular Component GO:0010008 endosome membrane Cellular Component GO:0031901 early endosome membrane Cellular Component GO:0031902 late endosome membrane Cellular Component GO:0035014 phosphatidylinositol 3-kinase regulator activity Molecular Function GO:0141039 phosphatidylinositol 3-kinase inhibitor activity Molecular Function |
| KEGG gene cross-reference | bta:540606 ddi:DDB_G0268084 dre:402898 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF24807.2WD40_CDC20-Fz315-470 aaPF25047.1Beta-prop_TEP1_2nd322-414 aaPF25391.2WD40_Gbeta323-410 aaPF23381.2Beta-prop_IFT122_1st325-412 aaPF25173.2Beta-prop_WDR3_1st325-442 aaPF25172.2Beta-prop_WDR3_2nd325-442 aaPF24814.2WD40_Prp19326-508 aaPF23409.2Beta-prop_EML326-552 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_014257 | PF24807.2 | WD40_CDC20-Fz | 315 | 470 | 6.6e-20 | 72.3 |
| LXL04_014257 | PF25047.1 | Beta-prop_TEP1_2nd | 322 | 414 | 1.1e-15 | 58.2 |
| LXL04_014257 | PF25391.2 | WD40_Gbeta | 323 | 410 | 7.9e-10 | 39.0 |
| LXL04_014257 | PF23381.2 | Beta-prop_IFT122_1st | 325 | 412 | 1.3e-25 | 91.0 |
| LXL04_014257 | PF25173.2 | Beta-prop_WDR3_1st | 325 | 442 | 1.4e-24 | 87.6 |
| LXL04_014257 | PF25172.2 | Beta-prop_WDR3_2nd | 325 | 442 | 4.5e-14 | 53.1 |
| LXL04_014257 | PF24814.2 | WD40_Prp19 | 326 | 508 | 4.1e-24 | 85.8 |
| LXL04_014257 | PF23409.2 | Beta-prop_EML | 326 | 552 | 1.3e-11 | 45.2 |
| LXL04_014257 | PF25175.2 | Beta-prop_WDR5 | 327 | 365 | 9.8e-29 | 101.3 |
| LXL04_014257 | PF00400.39 | WD40 | 327 | 360 | 9.5e-25 | 86.7 |
| LXL04_014257 | PF25171.2 | Beta-prop_WDR36-Utp21_1st | 328 | 441 | 1.8e-15 | 57.8 |
| LXL04_014257 | PF25460.2 | Beta-prop_Aladin | 329 | 553 | 2.2e-06 | 27.8 |
| LXL04_014257 | PF24817.2 | WD40_WDHD1_1st | 331 | 393 | 2.5e-24 | 86.7 |
| LXL04_014257 | PF25174.2 | Beta-prop_THOC3 | 332 | 550 | 8.7e-26 | 91.2 |
| LXL04_014257 | PF23414.2 | Beta-prop_EML_2 | 334 | 549 | 4e-16 | 59.9 |
| LXL04_014257 | PF24814.2 | WD40_Prp19 | 381 | 632 | 4.1e-24 | 85.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.