LXL04_014253 | RubberDandelionOmics

Gene overview

LXL04_014253

Reference: OH-1004 Chr: Chr03 Coordinates: 44613439-44618225 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2523 bp · LXL04_014253|LXL04_014253|OH1004|cDNA

ATGGACGTCGATATGAGCGAAGAGGATGAGTCAAAAGGTGGCATGTGGGCTTTAGAGCAGAAAATTGACCAGCCGATGGATGAAGAGGCTGGTAGGCTCAAAAATATGTATAGAGAAAAGAAATTCTCTGCAATTTTGCTTCTGAGATTTGCGTTTCAAAGTCTTGGAGTCGTTTATGGAGATTTAGGAACTTCTCCTTTATATGTATTTTACAATACTTTTCCAAAAGGAGTTGATGACACAGAAGACATCATTGGTGC...

CDS

Download CDS FASTA

2523 bp · LXL04_014253|LXL04_014253|OH1004|CDS

ATGGACGTCGATATGAGCGAAGAGGATGAGTCAAAAGGTGGCATGTGGGCTTTAGAGCAGAAAATTGACCAGCCGATGGATGAAGAGGCTGGTAGGCTCAAAAATATGTATAGAGAAAAGAAATTCTCTGCAATTTTGCTTCTGAGATTTGCGTTTCAAAGTCTTGGAGTCGTTTATGGAGATTTAGGAACTTCTCCTTTATATGTATTTTACAATACTTTTCCAAAAGGAGTTGATGACACAGAAGACATCATTGGTGC...

Protein

Download Protein FASTA

840 aa · LXL04_014253|LXL04_014253|OH1004|PROTEIN

MDVDMSEEDESKGGMWALEQKIDQPMDEEAGRLKNMYREKKFSAILLLRFAFQSLGVVYGDLGTSPLYVFYNTFPKGVDDTEDIIGALSLIIYSLTLVPLIKYVFIVCRANDNGQGGTFALYSLLCRHAKVNTIPNQHRTDEELTTYSRTTIHEKSFAAKTKRWLEGNLYKKNALLLLVLVGTCMAIGDGILTPAISVLSASGGIKIDHPAMSNDVVIVVAVVILLGLFSLQHYGPDKVGWLFAPIVFLWFLLIGGIGIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014253`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014253

Location Chr03:44613439-44618225 (+)

Description Similar to POT11: Potassium transporter 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g35060`	Probable potassium transporter.	No verified direct reference in this release
`At1g31120`	Putative potassium transporter.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0206400`	High-affinity potassium transporter.	No verified direct reference in this release
`Os04g0613900`	High-affinity potassium transporter.	No verified direct reference in this release
`Os09g0563200`	High-affinity potassium transporter.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014253 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006813 potassium ion transport Biological Process

GO:0009555 pollen development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0015079 potassium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G31120

ath:AT2G35060

dosa:Os04g0613900

dosa:Os09g0563200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.499

Rank 1 · LXL04_014253 · OH-1004

Lysosome / Vacuole0.264

Rank 2 · LXL04_014253 · OH-1004

Cytoplasm0.153

Rank 3 · LXL04_014253 · OH-1004

Endoplasmic reticulum0.109

Rank 4 · LXL04_014253 · OH-1004

Golgi apparatus0.090

Rank 5 · LXL04_014253 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02705.23K_trans50-519 aa

PF22776.1K_trans_C549-803 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014253	`PF02705.23`	K_trans	50	519	1e-159	532.6
LXL04_014253	`PF22776.1`	K_trans_C	549	803	3.7e-25	89.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64769`	Arabidopsis thaliana	Potassium transporter 11	75.970%	Swiss-Prot	strong database homology
`Q9SA05`	Arabidopsis thaliana	Potassium transporter 10	74.782%	Swiss-Prot	strong database homology
`Q8VXB1`	Oryza sativa subsp. japonica	Putative potassium transporter 12	73.024%	Swiss-Prot	strong database homology
`Q7XLC6`	Oryza sativa subsp. japonica	Probable potassium transporter 11	73.651%	Swiss-Prot	strong database homology
`Q653B6`	Oryza sativa subsp. japonica	Potassium transporter 18	71.875%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card