LXL04_014141 | RubberDandelionOmics

Gene overview

LXL04_014141

Reference: OH-1004 Chr: Chr03 Coordinates: 42621828-42623561 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

761 bp · LXL04_014141|LXL04_014141|OH1004|cDNA

ATGGCGGGTGTGTCACCCCTGGCCAAATACAAGTTGGTATTTTTGGGCGATCAATCCGTCGGCAAAACCAGCATCATTACCAGATTCATGTATGATAAATTCGACACCACCTATCAGGCAACAATTGGCATTGATTTCTTGTCTAAAACAATGTACCTTGAAGATAGAACAGTTCGGTTACAACTTTGGGATACTGCTGGGCAGGAGAGATTCAGGAGTCTGATTCCAAGTTACATTAGAGATTCATCAGTTGCTGTTAT...

CDS

Download CDS FASTA

624 bp · LXL04_014141|LXL04_014141|OH1004|CDS

ATGGCGGGTGTGTCACCCCTGGCCAAATACAAGTTGGTATTTTTGGGCGATCAATCCGTCGGCAAAACCAGCATCATTACCAGATTCATGTATGATAAATTCGACACCACCTATCAGGCAACAATTGGCATTGATTTCTTGTCTAAAACAATGTACCTTGAAGATAGAACAGTTCGGTTACAACTTTGGGATACTGCTGGGCAGGAGAGATTCAGGAGTCTGATTCCAAGTTACATTAGAGATTCATCAGTTGCTGTTAT...

Protein

Download Protein FASTA

207 aa · LXL04_014141|LXL04_014141|OH1004|PROTEIN

MAGVSPLAKYKLVFLGDQSVGKTSIITRFMYDKFDTTYQATIGIDFLSKTMYLEDRTVRLQLWDTAGQERFRSLIPSYIRDSSVAVIVYDVANRQSFLNTSKWIEEVRTERGSEVIIVLVGNKTDLVDKRQVSIEEGDGKAREFGVMFVETSAKAGFNIKPLFRKIAAALPGMDSHSSTKQEDMVDVNLKSSSNPNQSDHQGGGCAC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014141`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014141

Location Chr03:42621828-42623561 (-)

Description Similar to RABH1E: Ras-related protein RABH1e

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10260`	Protein transport.	No verified direct reference in this release
`At2g22290`	Protein transport.	No verified direct reference in this release
`At2g44610`	Protein transport.	No verified direct reference in this release
`At4g39890`	Protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014141 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001558 regulation of cell growth Biological Process

GO:0001881 receptor recycling Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006887 exocytosis Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0007602 phototransduction Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0032482 Rab protein signal transduction Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0052324 plant-type cell wall cellulose biosynthetic process Biological Process

GO:0060078 regulation of postsynaptic membrane potential Biological Process

KEGG gene cross-reference

ath:AT2G22290

ath:AT2G44610

ath:AT4G39890

ath:AT5G10260

dme:Dmel_CG6601

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.528

Rank 1 · LXL04_014141 · OH-1004

Golgi apparatus0.468

Rank 2 · LXL04_014141 · OH-1004

Lysosome / Vacuole0.155

Rank 3 · LXL04_014141 · OH-1004

Endoplasmic reticulum0.151

Rank 4 · LXL04_014141 · OH-1004

Cell membrane0.138

Rank 5 · LXL04_014141 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025.28Arf9-130 aa

PF00071.29Ras11-169 aa

PF08477.20Roc11-125 aa

PF00009.34GTP_EFTU43-171 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014141	`PF00025.28`	Arf	9	130	1.4e-14	54.7
LXL04_014141	`PF00071.29`	Ras	11	169	1.2e-57	194.7
LXL04_014141	`PF08477.20`	Roc	11	125	1.3e-37	129.4
LXL04_014141	`PF00009.34`	GTP_EFTU	43	171	1.5e-06	28.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFT9`	Arabidopsis thaliana	Ras-related protein RABH1e	91.304%	Swiss-Prot	strong database homology
`Q9SID8`	Arabidopsis thaliana	Ras-related protein RABH1d	88.406%	Swiss-Prot	strong database homology
`O80501`	Arabidopsis thaliana	Ras-related protein RABH1b	86.538%	Swiss-Prot	strong database homology
`Q9SMR4`	Arabidopsis thaliana	Ras-related protein RABH1c	84.184%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card