LXL04_014133 | RubberDandelionOmics

Gene overview

LXL04_014133

Reference: OH-1004 Chr: Chr03 Coordinates: 42470649-42474620 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1782 bp · LXL04_014133|LXL04_014133|OH1004|cDNA

ATGGATCAATACGAAGTGCTTGAGCAAATTGGAAAGGGGGCATTTGGTGCTGCCCTTCTTGTACGCCATAAACATGAAAGAAAAAAGTATGTGTTGAAAAAGATACGCCTTGCCCGCCAAACTGATAGAACACGTAGGTCTGCACATCAGGAGATGGAGCTTATTTCTAAAATGCGGAATCCCTTTATTGTGGAGTATAAAGATTCATGGGTTGAAAAGGGATGTTATGTATGCATTATTATAGGTTATTGCGAAGGTGG...

CDS

Download CDS FASTA

1782 bp · LXL04_014133|LXL04_014133|OH1004|CDS

ATGGATCAATACGAAGTGCTTGAGCAAATTGGAAAGGGGGCATTTGGTGCTGCCCTTCTTGTACGCCATAAACATGAAAGAAAAAAGTATGTGTTGAAAAAGATACGCCTTGCCCGCCAAACTGATAGAACACGTAGGTCTGCACATCAGGAGATGGAGCTTATTTCTAAAATGCGGAATCCCTTTATTGTGGAGTATAAAGATTCATGGGTTGAAAAGGGATGTTATGTATGCATTATTATAGGTTATTGCGAAGGTGG...

Protein

Download Protein FASTA

593 aa · LXL04_014133|LXL04_014133|OH1004|PROTEIN

MDQYEVLEQIGKGAFGAALLVRHKHERKKYVLKKIRLARQTDRTRRSAHQEMELISKMRNPFIVEYKDSWVEKGCYVCIIIGYCEGGDMAGAIKKANGMLFSEEKLCKWLVQLLMALDYLHLNHVLHRDVKCSNIFLTKDQDIRLGDFGLAKMLTSDDLASSVVGTPSYMCPELLADIPYGSKSDIWSLGCCIYEMTSHKAAFKAFDMQALINKINKSIVAPLPVKYTGAFRGLVKSMLRKNPELRPSAADLLRHQHLQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014133`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014133

Location Chr03:42470649-42474620 (-)

Description Similar to NEK2: Serine/threonine-protein kinase Nek2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04810`	May be involved in plant development processes.	No verified direct reference in this release
`At1g54510`	May be involved in plant development processes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0604700`	May be involved in plant development processes.	No verified direct reference in this release
`UniProt: A2ZMH2`	May be involved in plant development processes.	No verified direct reference in this release
`Os03g0636800`	May be involved in plant development processes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014133 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G54510

ath:AT3G04810

dosa:Os03g0636800

dosa:Os12g0604700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.666

Rank 1 · LXL04_014133 · OH-1004

Nucleus0.342

Rank 2 · LXL04_014133 · OH-1004

Cell membrane0.103

Rank 3 · LXL04_014133 · OH-1004

Mitochondrion0.056

Rank 4 · LXL04_014133 · OH-1004

Golgi apparatus0.040

Rank 5 · LXL04_014133 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase4-257 aa

PF07714.24PK_Tyr_Ser-Thr6-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014133	`PF00069.32`	Pkinase	4	257	6.6e-62	210.0
LXL04_014133	`PF07714.24`	PK_Tyr_Ser-Thr	6	254	1.1e-36	127.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAU7`	Arabidopsis thaliana	Serine/threonine-protein kinase Nek2	60.294%	Swiss-Prot	strong database homology
`Q9SLI2`	Arabidopsis thaliana	Serine/threonine-protein kinase Nek1	61.702%	Swiss-Prot	strong database homology
`Q2QMH1`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase Nek2	62.768%	Swiss-Prot	strong database homology
`A2ZMH2`	Oryza sativa subsp. indica	Serine/threonine-protein kinase Nek2	62.768%	Swiss-Prot	strong database homology
`Q10GB1`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase Nek1	61.692%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card