LXL04_014059 | RubberDandelionOmics

Gene overview

LXL04_014059

Reference: OH-1004 Chr: Chr03 Coordinates: 41412169-41412925 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

738 bp · LXL04_014059|LXL04_014059|OH1004|cDNA

ATGCTTACGAATTTAGAGAGCACCGATAAGCTCCCTTCCATGTCCGTCTTCAGTCAATTCGCCACTGCAACCAAGCTTATGCAGCCACACTTTGAACAAGCACTAGAGAAATTAATCCCCCATGTCACCTGCATCGTTTCCGATGGGTTTCTGAGTTGGACTCTTGAATCGGCGAATAAGTTTGGAATCCATCGCCTCTTCTATTTTGGCATGAGCGGCTACTCCACCGCCATAAGTCAACAAGTGGCTCTAAACCGGCT...

CDS

Download CDS FASTA

738 bp · LXL04_014059|LXL04_014059|OH1004|CDS

ATGCTTACGAATTTAGAGAGCACCGATAAGCTCCCTTCCATGTCCGTCTTCAGTCAATTCGCCACTGCAACCAAGCTTATGCAGCCACACTTTGAACAAGCACTAGAGAAATTAATCCCCCATGTCACCTGCATCGTTTCCGATGGGTTTCTGAGTTGGACTCTTGAATCGGCGAATAAGTTTGGAATCCATCGCCTCTTCTATTTTGGCATGAGCGGCTACTCCACCGCCATAAGTCAACAAGTGGCTCTAAACCGGCT...

Protein

Download Protein FASTA

245 aa · LXL04_014059|LXL04_014059|OH1004|PROTEIN

MLTNLESTDKLPSMSVFSQFATATKLMQPHFEQALEKLIPHVTCIVSDGFLSWTLESANKFGIHRLFYFGMSGYSTAISQQVALNRLLSGPEPDDDLITVTRLNLHSIRFSRRDIIETVGSDIKGFGIIPSEFLVGGEELRFEKRVGERGIIVREWVNQLEILKHESVKGFVSHCGSNSVLESICSEVPILAWPIMAEQPLNARMVVEEIKIDLQVETCNGSERDAEERETGETERKRERPEGER

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014059`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014059

Location Chr03:41412169-41412925 (-)

Description Similar to UGT90A1: UDP-glycosyltransferase 90A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g16890`	UDP-glycosyltransferase 90A1.	No verified direct reference in this release
`At1g10400`	UDP-glycosyltransferase 90A2.	No verified direct reference in this release
`At4g36770`	UDP-glycosyltransferase 72C1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014059 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009687 abscisic acid metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0035251 UDP-glucosyltransferase activity Molecular Function

GO:0080043 quercetin 3-O-glucosyltransferase activity Molecular Function

GO:0080044 quercetin 7-O-glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G10400

ath:AT2G16890

ath:AT4G36770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.794

Rank 1 · LXL04_014059 · OH-1004

Nucleus0.228

Rank 2 · LXL04_014059 · OH-1004

Peroxisome0.065

Rank 3 · LXL04_014059 · OH-1004

Endoplasmic reticulum0.057

Rank 4 · LXL04_014059 · OH-1004

Mitochondrion0.039

Rank 5 · LXL04_014059 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00201.25UDPGT151-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014059	`PF00201.25`	UDPGT	151	208	3.7e-14	53.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVX4`	Arabidopsis thaliana	UDP-glycosyltransferase 90A1	57.273%	Swiss-Prot	weak database homology
`Q9SY84`	Arabidopsis thaliana	UDP-glycosyltransferase 90A2	54.310%	Swiss-Prot	weak database homology
`O23205`	Arabidopsis thaliana	UDP-glycosyltransferase 72C1	51.087%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card