LXL04_013958 | RubberDandelionOmics

Gene overview

LXL04_013958

Reference: OH-1004 Chr: Chr03 Coordinates: 39104889-39107734 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1314 bp · LXL04_013958|LXL04_013958|OH1004|cDNA

ATGGCTTTCAACAAGATCAAGGTTGAAAACCCCATCGTTGAGATGGACGTCACTGGACTTATAGCTTCTAATTCTGTTGCAGGAGATGAAATGACTCGCATCTTTTGGCAATCAATCAAAGATAAGCTCATCTTCCCCTTCCTAGATCTTGACATAAAGTATTATGACCTTGGCCTTCCTAATCGTGATGCCACTGATGATAAAGTTACAGTAGAAAGTGCAGAAGCTACTCTCAAATACAATGTTGCAATTAAATGTGC...

CDS

Download CDS FASTA

1314 bp · LXL04_013958|LXL04_013958|OH1004|CDS

ATGGCTTTCAACAAGATCAAGGTTGAAAACCCCATCGTTGAGATGGACGTCACTGGACTTATAGCTTCTAATTCTGTTGCAGGAGATGAAATGACTCGCATCTTTTGGCAATCAATCAAAGATAAGCTCATCTTCCCCTTCCTAGATCTTGACATAAAGTATTATGACCTTGGCCTTCCTAATCGTGATGCCACTGATGATAAAGTTACAGTAGAAAGTGCAGAAGCTACTCTCAAATACAATGTTGCAATTAAATGTGC...

Protein

Download Protein FASTA

437 aa · LXL04_013958|LXL04_013958|OH1004|PROTEIN

MAFNKIKVENPIVEMDVTGLIASNSVAGDEMTRIFWQSIKDKLIFPFLDLDIKYYDLGLPNRDATDDKVTVESAEATLKYNVAIKCATITPDEARMKEFTLKSMWRSPNGTIRNILNGTVFREPILCKNIPRLIPGWTKPICIGRHAFGDQYKATDAVIKGPGKLKLVFVPEGEGEKLDLEVYNFTGAGGVAQSMYNTDESITAFAEASMNTAYEKKWPLYLSTKNTILKKYDGRFKDIFQQVYESNWKSKFDAAGIWYE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013958`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013958

Location Chr03:39104889-39107734 (+)

Description Similar to Isocitrate dehydrogenase [NADP]

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65930`	May supply 2-oxoglutarate for amino acid biosynthesis and ammonia assimilation via the glutamine synthetase/glutamate synthase (GS/GOGAT) pathway.	Cytosolic NADP-dependent isocitrate dehydrogenase contributes to redox homeostasis and the regulation of pathogen responses in Arabidopsis leaves.2010 · DOI: 10.1111/j.1365-3040.2010.02133.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013958 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006102 isocitrate metabolic process Biological Process

GO:0006739 NADP+ metabolic process Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G65930

nta:107815853

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.560

Rank 1 · LXL04_013958 · OH-1004

Peroxisome0.225

Rank 2 · LXL04_013958 · OH-1004

Nucleus0.154

Rank 3 · LXL04_013958 · OH-1004

Mitochondrion0.144

Rank 4 · LXL04_013958 · OH-1004

Cell membrane0.045

Rank 5 · LXL04_013958 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00180.26Iso_dh26-413 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013958	`PF00180.26`	Iso_dh	26	413	5.1e-76	256.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRZ6`	Arabidopsis thaliana	Cytosolic isocitrate dehydrogenase [NADP]	84.323%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card