LXL04_013897 | RubberDandelionOmics

Gene overview

LXL04_013897

Reference: OH-1004 Chr: Chr03 Coordinates: 37655768-37658163 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1626 bp · LXL04_013897|LXL04_013897|OH1004|cDNA

ATGGCCGCCGAGAAACAATCGTCGATGGCGGAGACGGAATCCTACCCACCGATCGACCCGACTAACTTTGACCTGATCGTCGTCGGCACCGGCCTGCCTGAATCGATCATCGCCGCCGCAGCCTCTACCTCCGGCAAAACTGTACTCCATCTCGATCCTAACCCCTTCTACGGTTCCCACTACTCTTCCCTCAGTCTCCAAGACCTCACTTCCCTCCTCCAATCCAACTCCGAAAACCCTAAACCCAATCTCCCCCAATC...

CDS

Download CDS FASTA

1626 bp · LXL04_013897|LXL04_013897|OH1004|CDS

ATGGCCGCCGAGAAACAATCGTCGATGGCGGAGACGGAATCCTACCCACCGATCGACCCGACTAACTTTGACCTGATCGTCGTCGGCACCGGCCTGCCTGAATCGATCATCGCCGCCGCAGCCTCTACCTCCGGCAAAACTGTACTCCATCTCGATCCTAACCCCTTCTACGGTTCCCACTACTCTTCCCTCAGTCTCCAAGACCTCACTTCCCTCCTCCAATCCAACTCCGAAAACCCTAAACCCAATCTCCCCCAATC...

Protein

Download Protein FASTA

541 aa · LXL04_013897|LXL04_013897|OH1004|PROTEIN

MAAEKQSSMAETESYPPIDPTNFDLIVVGTGLPESIIAAAASTSGKTVLHLDPNPFYGSHYSSLSLQDLTSLLQSNSENPKPNLPQSDDTTTLDINPRPIYSDVEIASYDGSVEEHSRKFNLDLAGPRVLFCADLSVDLLLKSTANQYVEFKNIDASYVGDANGNLTNVPDSKSAVFKDKTLKYSEKNQLNSFFKLVQGHLEAVKSVGLDVAVDDGKIISEEDLESPFVVFLDKMKLPPKIKSIILYAIAMVDHDQDTGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013897`
TK1151 ID	TkA02G465740
OH-1004 ID	LXL04_013897
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013897

Location Chr03:37655768-37658163 (+)

Description Similar to REP: Rab escort protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06540`	Substrate-binding subunit of the Rab geranylgeranyltransferase (GGTase) complex.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013897 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006612 protein targeting to membrane Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0007264 small GTPase-mediated signal transduction Biological Process

GO:0009555 pollen development Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010152 pollen maturation Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0018344 protein geranylgeranylation Biological Process

GO:1905552 positive regulation of protein localization to endoplasmic reticulum Biological Process

GO:2000541 positive regulation of protein geranylgeranylation Biological Process

GO:0000922 spindle pole Cellular Component

KEGG gene cross-reference

ath:AT3G06540

cel:CELE_Y67D2.1

dme:Dmel_CG8432

mmu:12663

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.707

Rank 1 · LXL04_013897 · OH-1004

Nucleus0.424

Rank 2 · LXL04_013897 · OH-1004

Mitochondrion0.057

Rank 3 · LXL04_013897 · OH-1004

Peroxisome0.047

Rank 4 · LXL04_013897 · OH-1004

Endoplasmic reticulum0.037

Rank 5 · LXL04_013897 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00996.25GDI22-102 aa

PF00996.25GDI116-437 aa

PF22603.3RAE1_2_domI_C375-473 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013897	`PF00996.25`	GDI	22	102	3.4e-45	155.1
LXL04_013897	`PF00996.25`	GDI	116	437	3.4e-45	155.1
LXL04_013897	`PF22603.3`	RAE1_2_domI_C	375	473	3.1e-09	37.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LLD4`	Arabidopsis thaliana	Rab escort protein 1	56.284%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card