LXL04_013768 | RubberDandelionOmics

Gene overview

LXL04_013768

Reference: OH-1004 Chr: Chr03 Coordinates: 35672675-35673907 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

899 bp · LXL04_013768|LXL04_013768|OH1004|cDNA

ATGGTCATCTATGAATCGGAGGGGATCCAGGAGAACGAAATCTATGACGCCATGGAAGTCTATATTGCTGCTAAAATGTCTACCGACATCCACCGGTTCAAGGTCAGCAAACATCCTAAACAGAACAACGTGGCTGTTGCCATGGAAGTCAACGAGAAGTTTACCGATATTTACAAGGGAATCAAAGTCTACTGGTCCTCAGAGTCCAAGAACACGCCGACTAGGAAAATTCACAGTCACGATGACATGAATTCTTCTTC...

CDS

Download CDS FASTA

861 bp · LXL04_013768|LXL04_013768|OH1004|CDS

ATGGTCATCTATGAATCGGAGGGGATCCAGGAGAACGAAATCTATGACGCCATGGAAGTCTATATTGCTGCTAAAATGTCTACCGACATCCACCGGTTCAAGGTCAGCAAACATCCTAAACAGAACAACGTGGCTGTTGCCATGGAAGTCAACGAGAAGTTTACCGATATTTACAAGGGAATCAAAGTCTACTGGTCCTCAGAGTCCAAGAACACGCCGACTAGGAAAATTCACAGTCACGATGACATGAATTCTTCTTC...

Protein

Download Protein FASTA

286 aa · LXL04_013768|LXL04_013768|OH1004|PROTEIN

MVIYESEGIQENEIYDAMEVYIAAKMSTDIHRFKVSKHPKQNNVAVAMEVNEKFTDIYKGIKVYWSSESKNTPTRKIHSHDDMNSSSKTAELRKQEEKTLKLFTLSPHPRLARSRWMSIDLDHPANFTTLAMDSDIKEKVMNDLDRFVERREYYRRVGKAWKRANRSILVVEDIDCSKELHDRAATTAAMATIEKPHRERSKLLTLSGFLNFIDGLWSSCGDERIIIFTTNHKDKLDPALIRPGRMDVHTGTEPANNFRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013768`
TK1151 ID	TkA02G473250
OH-1004 ID	LXL04_013768
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 86.842 / OH-1004 92.308 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013768

Location Chr03:35672675-35673907 (+)

Description Similar to HSR4: Protein HYPER-SENSITIVITY-RELATED 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50930`	Protein HYPER-SENSITIVITY-RELATED 4.	No verified direct reference in this release
`At3g50940`	AAA-ATPase At3g50940.	No verified direct reference in this release
`At2g18193`	AAA-ATPase At2g18193.	No verified direct reference in this release
`At2g18190`	AAA-ATPase At2g18190.	No verified direct reference in this release
`At5g17730`	AAA-ATPase At5g17730.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013768 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006950 response to stress Biological Process

GO:0009411 response to UV Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0012501 programmed cell death Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005740 mitochondrial envelope Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT2G18190

ath:AT2G18193

ath:AT3G50930

ath:AT3G50940

ath:AT5G17730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.337

Rank 1 · LXL04_013768 · OH-1004

Nucleus0.238

Rank 2 · LXL04_013768 · OH-1004

Endoplasmic reticulum0.199

Rank 3 · LXL04_013768 · OH-1004

Cell membrane0.118

Rank 4 · LXL04_013768 · OH-1004

Mitochondrion0.117

Rank 5 · LXL04_013768 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14363.12AAA_assoc1-67 aa

PF00004.36AAA159-250 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013768	`PF14363.12`	AAA_assoc	1	67	3.3e-15	57.0
LXL04_013768	`PF00004.36`	AAA	159	250	2.1e-06	29.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZG2`	Arabidopsis thaliana	Protein HYPER-SENSITIVITY-RELATED 4	43.161%	Swiss-Prot	moderate database homology
`Q147F9`	Arabidopsis thaliana	AAA-ATPase At3g50940	37.846%	Swiss-Prot	moderate database homology
`Q8GW96`	Arabidopsis thaliana	AAA-ATPase At2g18193	35.535%	Swiss-Prot	moderate database homology
`F4IQG2`	Arabidopsis thaliana	AAA-ATPase At2g18190	35.737%	Swiss-Prot	moderate database homology
`Q9FN78`	Arabidopsis thaliana	AAA-ATPase At5g17730	34.505%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card