LXL04_013734 | RubberDandelionOmics

Gene overview

LXL04_013734

Reference: OH-1004 Chr: Chr03 Coordinates: 34967470-34977219 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4344 bp · LXL04_013734|LXL04_013734|OH1004|cDNA

ATGAGGGATCATACCGAGCGATTTCTCATTTCACCTGGTTTAGCTGATTACTCTAGCAACACGGATCACTCCGATGATGGCTCTTACGACTTACTTTCTTCCGATCTGTCTGATTTACTTGTTCTAACCAAAGGAGAAGCTTCTAATACCACAGCTGCTTACGAAGACAACCTCTCTGCTCAAATCAACTCCTTTTCTTTCGAATCAGATAACGAAGCCAAATCTAATCCTTCAGAAGAAGAaacggaagaagaagaaga...

CDS

Download CDS FASTA

4344 bp · LXL04_013734|LXL04_013734|OH1004|CDS

ATGAGGGATCATACCGAGCGATTTCTCATTTCACCTGGTTTAGCTGATTACTCTAGCAACACGGATCACTCCGATGATGGCTCTTACGACTTACTTTCTTCCGATCTGTCTGATTTACTTGTTCTAACCAAAGGAGAAGCTTCTAATACCACAGCTGCTTACGAAGACAACCTCTCTGCTCAAATCAACTCCTTTTCTTTCGAATCAGATAACGAAGCCAAATCTAATCCTTCAGAAGAAGAAACGGAAGAAGAAGAAGA...

Protein

Download Protein FASTA

1447 aa · LXL04_013734|LXL04_013734|OH1004|PROTEIN

MRDHTERFLISPGLADYSSNTDHSDDGSYDLLSSDLSDLLVLTKGEASNTTAAYEDNLSAQINSFSFESDNEAKSNPSEEETEEEEEFSGMDFPDNVDTGKKRNFMTMAYENSYFDIHDYPSHIKLKDNITIKEMAKNHILRYLPAKSLARCQLVSKEWDSWISTPFFAHTQSQYFNQTSGFFHDNENEHISFISLDTSSYGVPDPSLYFLPQNVSIKSSCNGLLLCQAFHDENKYYICNPTNKQWIELPFSTYYHGKQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013734`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013734

Location Chr03:34967470-34977219 (+)

Description Similar to At5g07610: F-box protein At5g07610

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g07610`	F-box protein At5g07610.	No verified direct reference in this release
`At5g49610`	F-box protein At5g49610.	No verified direct reference in this release
`At1g32420`	Putative F-box protein At1g32420.	No verified direct reference in this release
`At4g09190`	Putative F-box protein At4g09190.	No verified direct reference in this release
`At5g03970`	F-box protein At5g03970.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013734 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G07610

ath:AT5G49610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.642

Rank 1 · LXL04_013734 · OH-1004

Nucleus0.411

Rank 2 · LXL04_013734 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_013734 · OH-1004

Endoplasmic reticulum0.062

Rank 4 · LXL04_013734 · OH-1004

Lysosome / Vacuole0.035

Rank 5 · LXL04_013734 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box138-166 aa

PF12937.13F-box-like139-166 aa

PF08268.18FBA_3211-383 aa

PF03478.25Beta-prop_KIB1-4213-372 aa

PF24750.2b-prop_At3g26010-like215-344 aa

PF00646.39F-box619-648 aa

PF12937.13F-box-like619-646 aa

PF03478.25Beta-prop_KIB1-4693-870 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013734	`PF00646.39`	F-box	138	166	2.6e-20	72.1
LXL04_013734	`PF12937.13`	F-box-like	139	166	1.2e-18	67.3
LXL04_013734	`PF08268.18`	FBA_3	211	383	2e-23	83.6
LXL04_013734	`PF03478.25`	Beta-prop_KIB1-4	213	372	2.1e-18	67.5
LXL04_013734	`PF24750.2`	b-prop_At3g26010-like	215	344	2.6e-25	90.0
LXL04_013734	`PF00646.39`	F-box	619	648	2.6e-20	72.1
LXL04_013734	`PF12937.13`	F-box-like	619	646	1.2e-18	67.3
LXL04_013734	`PF03478.25`	Beta-prop_KIB1-4	693	870	2.1e-18	67.5
LXL04_013734	`PF24750.2`	b-prop_At3g26010-like	696	825	2.6e-25	90.0
LXL04_013734	`PF08268.18`	FBA_3	696	840	2e-23	83.6
LXL04_013734	`PF00646.39`	F-box	1111	1142	2.6e-20	72.1
LXL04_013734	`PF12937.13`	F-box-like	1113	1140	1.2e-18	67.3
LXL04_013734	`PF24750.2`	b-prop_At3g26010-like	1187	1318	2.6e-25	90.0
LXL04_013734	`PF08268.18`	FBA_3	1188	1323	2e-23	83.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLS0`	Arabidopsis thaliana	F-box protein At5g07610	32.114%	Swiss-Prot	weak database homology
`Q9FGY4`	Arabidopsis thaliana	F-box protein At5g49610	28.821%	Swiss-Prot	weak database homology
`Q9LQL5`	Arabidopsis thaliana	Putative F-box protein At1g32420	29.412%	Swiss-Prot	weak database homology
`Q9M0Q9`	Arabidopsis thaliana	Putative F-box protein At4g09190	25.820%	Swiss-Prot	weak database homology
`Q94A64`	Arabidopsis thaliana	F-box protein At5g03970	24.561%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card