LXL04_013681 | RubberDandelionOmics

Gene overview

LXL04_013681

Reference: OH-1004 Chr: Chr03 Coordinates: 34091825-34094806 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2982 bp · LXL04_013681|LXL04_013681|OH1004|cDNA

ATGGGAGATCCAATCGTGTCTTCTGTAGTCAATCAAGTAATGGAAAGATCCACATCTTTAGCAGCCCAAGATTTCGCGGTTTTATGGGGCCTCAAGTCCGATCTCCGGTCTTTACGGACCATTTTTACTCAGATCCAAGCGGTGCTCGCCGACGCTGAAGTCAAACAGAGGAAGAACAAAGCGTTACAGGACTGGCTAAGGAAACTCAGAGCTGCATCTTTCGAGGTCGAGAACGTGTTAGAAGAGGTCTCTACCGAAGC...

CDS

Download CDS FASTA

2982 bp · LXL04_013681|LXL04_013681|OH1004|CDS

ATGGGAGATCCAATCGTGTCTTCTGTAGTCAATCAAGTAATGGAAAGATCCACATCTTTAGCAGCCCAAGATTTCGCGGTTTTATGGGGCCTCAAGTCCGATCTCCGGTCTTTACGGACCATTTTTACTCAGATCCAAGCGGTGCTCGCCGACGCTGAAGTCAAACAGAGGAAGAACAAAGCGTTACAGGACTGGCTAAGGAAACTCAGAGCTGCATCTTTCGAGGTCGAGAACGTGTTAGAAGAGGTCTCTACCGAAGC...

Protein

Download Protein FASTA

993 aa · LXL04_013681|LXL04_013681|OH1004|PROTEIN

MGDPIVSSVVNQVMERSTSLAAQDFAVLWGLKSDLRSLRTIFTQIQAVLADAEVKQRKNKALQDWLRKLRAASFEVENVLEEVSTEALLRRLHVERGIKNRVSTFFSASNPLQFRIKMVQKVKDIKELLDAIAAERINFELVEGINHFEVLADIETRTICLIDSEIVGRVEEKEMIIDKIRTNFNTLDHDRVHVYTISGVGGLGKTTLAQLIYNDPRVDKLFDLKLWLRVSNDFSTITLTREILKSIERDSDSPNLSHTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013681`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013681

Location Chr03:34091825-34094806 (-)

Description Similar to RGA2: Disease resistance protein RGA2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013681 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.542

Rank 1 · LXL04_013681 · OH-1004

Cytoplasm0.283

Rank 2 · LXL04_013681 · OH-1004

Nucleus0.203

Rank 3 · LXL04_013681 · OH-1004

Endoplasmic reticulum0.055

Rank 4 · LXL04_013681 · OH-1004

Plastid0.053

Rank 5 · LXL04_013681 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052.7Rx_N9-93 aa

PF00931.29NB-ARC185-350 aa

PF23559.2WHD_DRP439-513 aa

PF23598.2LRR_14558-860 aa

PF23286.1LRR_13562-667 aa

PF13855.13LRR_8581-638 aa

PF25019.1LRR_R13L1-DRL21606-662 aa

PF25019.1LRR_R13L1-DRL21692-816 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013681	`PF18052.7`	Rx_N	9	93	4.6e-20	72.2
LXL04_013681	`PF00931.29`	NB-ARC	185	350	2.5e-30	106.0
LXL04_013681	`PF23559.2`	WHD_DRP	439	513	2.4e-22	79.4
LXL04_013681	`PF23598.2`	LRR_14	558	860	2e-37	129.5
LXL04_013681	`PF23286.1`	LRR_13	562	667	1.1e-07	32.5
LXL04_013681	`PF13855.13`	LRR_8	581	638	2.4e-09	37.5
LXL04_013681	`PF25019.1`	LRR_R13L1-DRL21	606	662	2.1e-47	160.9
LXL04_013681	`PF25019.1`	LRR_R13L1-DRL21	692	816	2.1e-47	160.9
LXL04_013681	`PF23247.2`	LRR_RPS2	864	964	1.8e-13	51.5
LXL04_013681	`PF23598.2`	LRR_14	875	964	2e-37	129.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRR4`	Arabidopsis thaliana	Putative disease resistance RPP13-like protein 1	31.232%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card