LXL04_013575 | RubberDandelionOmics

Gene overview

LXL04_013575

Reference: OH-1004 Chr: Chr03 Coordinates: 31985956-31986400 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

312 bp · LXL04_013575|LXL04_013575|OH1004|cDNA

ATGGCCTTCCCCGATGCGATTCACGCATTTAAACCAAACCCTAAATCGCACATCCAGGAAGACAGGAGAATTCTCGATTTCCTGTCCCACCATCCGGAAAGCTTAAACACCATGAAATTCTGGCTCGATGATGTTGGCATcctcttaattttttttataatcatcTTAGGTCTGTCAAATTTAATCATGGGTTTCTATTTGGGAAATCCAACACACGAACACAAAGGGTTTGCTAAATTTATCTTACATTTTGGCCTGTT...

CDS

Download CDS FASTA

312 bp · LXL04_013575|LXL04_013575|OH1004|CDS

ATGGCCTTCCCCGATGCGATTCACGCATTTAAACCAAACCCTAAATCGCACATCCAGGAAGACAGGAGAATTCTCGATTTCCTGTCCCACCATCCGGAAAGCTTAAACACCATGAAATTCTGGCTCGATGATGTTGGCATCCTCTTAATTTTTTTTATAATCATCTTAGGTCTGTCAAATTTAATCATGGGTTTCTATTTGGGAAATCCAACACACGAACACAAAGGGTTTGCTAAATTTATCTTACATTTTGGCCTGTT...

Protein

Download Protein FASTA

103 aa · LXL04_013575|LXL04_013575|OH1004|PROTEIN

MAFPDAIHAFKPNPKSHIQEDRRILDFLSHHPESLNTMKFWLDDVGILLIFFIIILGLSNLIMGFYLGNPTHEHKGFAKFILHFGLLIAIIFNLGFQTISENE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013575`
TK1151 ID	TkA02G487150
OH-1004 ID	LXL04_013575
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013575

Location Chr03:31985956-31986400 (-)

Description Similar to CAT2: Catalase-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35090`	Catalyzes the degradation of hydrogen peroxide (H(2)O(2)) generated by peroxisomal oxidases to water and oxygen, thereby protecting cells from the toxic effects of hydrogen peroxide.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0115700`	Occurs in almost all aerobically respiring organisms and serves to protect cells from the toxic effects of hydrogen peroxide (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013575 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009648 photoperiodism Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009970 cellular response to sulfate starvation Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

KEGG gene cross-reference

ath:AT4G35090

dosa:Os02g0115700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.273

Rank 1 · LXL04_013575 · OH-1004

Plastid0.153

Rank 2 · LXL04_013575 · OH-1004

Mitochondrion0.142

Rank 3 · LXL04_013575 · OH-1004

Golgi apparatus0.141

Rank 4 · LXL04_013575 · OH-1004

Cytoplasm0.126

Rank 5 · LXL04_013575 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00199.25Catalase1-47 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013575	`PF00199.25`	Catalase	1	47	8.7e-08	32.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P25819`	Arabidopsis thaliana	Catalase-2	72.340%	Swiss-Prot	weak database homology
`Q0E4K1`	Oryza sativa subsp. japonica	Catalase isozyme A	70.213%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card