LXL04_013560 | RubberDandelionOmics

Gene overview

LXL04_013560

Reference: OH-1004 Chr: Chr03 Coordinates: 31452136-31454495 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2037 bp · LXL04_013560|LXL04_013560|OH1004|cDNA

ATGGAACAAAACTCATGGCCTTGGACAAAATCATCCACAGAGAAAACAATGATTCCATCTGACAAAGTGAATGAAGATGAGACAAATTTGAAAACTTCAGATGAAAAGCTTTCAGAGATCAATGCTAAAGATGACATCACAAAGAAGCAAACAAGCATTGCACGAGAAGCCATTCAAGGATGGGAGAAAGCTGAAACGGAAGTTTTAGCGTTAAAGCAAGAACTAGAAAAAGCTACGCAACAAAGAGAAGCATTAAATGA...

CDS

Download CDS FASTA

2037 bp · LXL04_013560|LXL04_013560|OH1004|CDS

ATGGAACAAAACTCATGGCCTTGGACAAAATCATCCACAGAGAAAACAATGATTCCATCTGACAAAGTGAATGAAGATGAGACAAATTTGAAAACTTCAGATGAAAAGCTTTCAGAGATCAATGCTAAAGATGACATCACAAAGAAGCAAACAAGCATTGCACGAGAAGCCATTCAAGGATGGGAGAAAGCTGAAACGGAAGTTTTAGCGTTAAAGCAAGAACTAGAAAAAGCTACGCAACAAAGAGAAGCATTAAATGA...

Protein

Download Protein FASTA

678 aa · LXL04_013560|LXL04_013560|OH1004|PROTEIN

MEQNSWPWTKSSTEKTMIPSDKVNEDETNLKTSDEKLSEINAKDDITKKQTSIAREAIQGWEKAETEVLALKQELEKATQQREALNECMLQIRFVREEQEKKIHGDLMKTSNEHEIKISELNKKVSDLELDNSQLMYALSSKEKTIDQLDYDLRSVVGQLESTQRENASLSYEVRVLEKELEIRNEEREFNRRAADVAHKQYLGSVKKIAQLETEAQRLRALLQKRLPGPADVAKMKNAVDHTRRRSNPLPIASKITFLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013560`
TK1151 ID	TkA02G489940
OH-1004 ID	LXL04_013560
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 98.750 / OH-1004 81.563 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013560

Location Chr03:31452136-31454495 (-)

Description Similar to FPP7: Filament-like plant protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g23360`	Filament-like plant protein 7.	No verified direct reference in this release
`At1g19835`	Filament-like plant protein 4.	No verified direct reference in this release
`At1g47900`	Filament-like plant protein 6.	No verified direct reference in this release
`At4g36120`	Filament-like plant protein 5.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013560 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010090 trichome morphogenesis Biological Process

GO:0046785 microtubule polymerization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT1G19835

ath:AT1G47900

ath:AT2G23360

ath:AT4G36120

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.479

Rank 1 · LXL04_013560 · OH-1004

Cell membrane0.331

Rank 2 · LXL04_013560 · OH-1004

Nucleus0.308

Rank 3 · LXL04_013560 · OH-1004

Endoplasmic reticulum0.055

Rank 4 · LXL04_013560 · OH-1004

Golgi apparatus0.049

Rank 5 · LXL04_013560 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05911.17FPP43-243 aa

PF05911.17FPP283-347 aa

PF05911.17FPP337-455 aa

PF05911.17FPP501-576 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013560	`PF05911.17`	FPP	43	243	1.9e-107	361.4
LXL04_013560	`PF05911.17`	FPP	283	347	1.9e-107	361.4
LXL04_013560	`PF05911.17`	FPP	337	455	1.9e-107	361.4
LXL04_013560	`PF05911.17`	FPP	501	576	1.9e-107	361.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SLN1`	Arabidopsis thaliana	Filament-like plant protein 7	38.642%	Swiss-Prot	weak database homology
`Q0WSY2`	Arabidopsis thaliana	Filament-like plant protein 4	33.333%	Swiss-Prot	weak database homology
`Q9C698`	Arabidopsis thaliana	Filament-like plant protein 6	31.002%	Swiss-Prot	weak database homology
`O65649`	Arabidopsis thaliana	Filament-like plant protein 5	38.800%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card