LXL04_013476 | RubberDandelionOmics

Gene overview

LXL04_013476

Reference: OH-1004 Chr: Chr03 Coordinates: 30167634-30168701 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · LXL04_013476|LXL04_013476|OH1004|cDNA

ATGTCAAATTCAGAACACAACACAGATCTAGACTCCTACCAAGATGCTTGTCAAACGGATCCGGAGCTCCAGTCCTTCGATTCCACCCTCCAAGGCCGCACCAGTAGAGTAATTAACACTCTCGCCGACGGCGTCGAGGTCCGTTCCCTTTCCCTTGACTCCCTCCGTGAAGTCACCGGAAGTTTACTAGACATGAATCAGCAAGTTGTCAAAGTTATACTTGAATGCAAAAAGGACATTTGGGACAATGACCAATTGTT...

CDS

Download CDS FASTA

1068 bp · LXL04_013476|LXL04_013476|OH1004|CDS

ATGTCAAATTCAGAACACAACACAGATCTAGACTCCTACCAAGATGCTTGTCAAACGGATCCGGAGCTCCAGTCCTTCGATTCCACCCTCCAAGGCCGCACCAGTAGAGTAATTAACACTCTCGCCGACGGCGTCGAGGTCCGTTCCCTTTCCCTTGACTCCCTCCGTGAAGTCACCGGAAGTTTACTAGACATGAATCAGCAAGTTGTCAAAGTTATACTTGAATGCAAAAAGGACATTTGGGACAATGACCAATTGTT...

Protein

Download Protein FASTA

355 aa · LXL04_013476|LXL04_013476|OH1004|PROTEIN

MSNSEHNTDLDSYQDACQTDPELQSFDSTLQGRTSRVINTLADGVEVRSLSLDSLREVTGSLLDMNQQVVKVILECKKDIWDNDQLFSLVEEYFEISIQTLDFCSSLENCLKDARSTLSFLQIAINQYDADTNHLNTLDQLKQFKEFDSPFSVEFFELFQSVYKKQLAMLKKLQIEKWKVDKKMKSTKTWRRLSNVIFVTAFSTVLICSVVAAAIAAPPVVTALAAAAAVPLGSMGKWVNSLWKKYEREFKDQREMISAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013476`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013476

Location Chr03:30167634-30168701 (+)

Description Similar to At4g34320: UPF0496 protein At4g34320

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34320`	UPF0496 protein At4g34320.	No verified direct reference in this release
`At2g18630`	UPF0496 protein At2g18630.	No verified direct reference in this release
`At5g66675`	UPF0496 protein At5g66675.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0199100`	UPF0496 protein 1.	No verified direct reference in this release
`UniProt: A2XDK8`	UPF0496 protein 1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013476 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G18630

ath:AT4G34320

ath:AT5G66675

dosa:Os03g0199100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.440

Rank 1 · LXL04_013476 · OH-1004

Cell membrane0.387

Rank 2 · LXL04_013476 · OH-1004

Nucleus0.236

Rank 3 · LXL04_013476 · OH-1004

Lysosome / Vacuole0.069

Rank 4 · LXL04_013476 · OH-1004

Endoplasmic reticulum0.068

Rank 5 · LXL04_013476 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05633.17ROH1-like17-130 aa

PF05055.18DUF67723-347 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013476	`PF05633.17`	ROH1-like	17	130	3e-09	37.1
LXL04_013476	`PF05055.18`	DUF677	23	347	4.6e-109	365.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYZ7`	Arabidopsis thaliana	UPF0496 protein At4g34320	54.213%	Swiss-Prot	strong database homology
`Q56XQ0`	Arabidopsis thaliana	UPF0496 protein At2g18630	52.514%	Swiss-Prot	strong database homology
`Q8GW16`	Arabidopsis thaliana	UPF0496 protein At5g66675	49.315%	Swiss-Prot	moderate database homology
`Q10QE9`	Oryza sativa subsp. japonica	UPF0496 protein 1	54.775%	Swiss-Prot	strong database homology
`A2XDK8`	Oryza sativa subsp. indica	UPF0496 protein 1	54.775%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card